Gene ANK1 Variant 3
DNA : 144.40 KbNT_008251
mRNA : 8292 bp NM_000037
CDS : 7146 bp NP_000028
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  111 bp
ggccgaggcctggggagcggggcctcctggggttgggggaggaggtgctcttgtaatctg
cggtccccaggcgggcgccacccctccgcccgcccgtgccgggagcgcccggcccgacag
caagcgcctctggggccgataaggccctcgggggcctggcccgcacgtcacaggccccgc
AGAGGCTGCGGTGAGTCCGCCAGCCCCAGCTGCTCCTCCTCAAGCCCCCAAGGCCCTTCG
GCGGGCCCCTGCTGAAAGACCGGCATGCCCTATTCTGTGGGCTTCCGCGAA
gtgagtactgggcggctgctcgggtggacggggagatgtcaggagggggccacccaggcc
gcgccagtaggcagcacgcgagcaagagcagctttgcacaccccacccgcctcgcctccc
cgtgggctccctgccttagcatagcggcacatcgaccttgtagctgaaggcagcaggtgg
EXON 2  102 bp
tgggtgtgaaggcagtccaaccaggggctctcaggctcctgtgcacacctggtgtcactg
tgggcaccagggtgccacatcagaggatgcaggggctgctgcgggggcctgggacttgaa
cggggtggagaagtcattaatacacccaggacactcaccgcctgttgtttttcctcacag
GCCGATGCTGCTACCAGCTTTCTGAGAGCAGCAAGATCAGGTAACTTGGACAAAGCTTTG
GATCACCTGCGGAATGGGGTAGATATTAACACCTGTAACCAG
gtaagtgggatggaggcaggcctgttgtctctgaagagtagctcttgcctgatgccattt
cctgagagctttgaaactgcctctattaaccttttctcagtggcctcaaaactcccccag
ggctcctgcctgtggaaggccctaaccttgctgtttccactcctgccgtggcccagggcc
EXON 3  99 bp
gcgtgaaggggaggctgggtggccctgccctgtgccccttccaacctctagacacactcc
actccttttctccagtgctgtgaacacctcagggctgggaaggggcctgggcccccactg
ggacgtgcagaaagcaccatttgactaaccatgcccttcccgcctctctgctctttacag
AATGGGTTGAATGGCTTGCATCTGGCTTCTAAGGAAGGCCATGTGAAAATGGTGGTTGAA
CTTCTGCACAAAGAAATCATTCTAGAAACGACAACCAAG
gtatgtctcacagggagtgggggagctttgcattgaaaattcaagtttgtgagtccttcc
ttagaaaccagtccttcatgagagaactcaggcatgcatctgaatttctcttatccttcc
aatcactttttagttctctgaatccctgaagctgcctgaaacagaccccatttccagaaa
EXON 4  99 bp
actttcagtatgatttcaggatgtgcaatgggtcaagcacacacgtgtgtcctttctacc
ccttttggccatgaagaaagcccccgggtccctcaagcagcacctgtccacagacctttg
ctggtcccgtagcgggcccagtgggaaaccgcctctgttcccttcccccatgtgtttcag
AAGGGGAACACGGCCCTGCACATCGCTGCTCTAGCCGGGCAGGATGAGGTGGTCCGGGAG
CTTGTCAACTATGGAGCCAACGTCAACGCCCAGTCACAG
gtaatggctctctggtctggactagagggtgttgcctttccacaggtggttcctctttgc
tgctccctcgtgggtccattggcagccgtgttaacacacacactactgtggggcagggcc
tagatttctcaggagcatgtctctgagcagtggtgaaggtgtcctttattatttcgcatg
EXON 5  99 bp
tggccttttgtaataatcccaggacgccagtcaccatgacaatgagtttccttaggaggg
gtcaggtgggaggaaatggaatgaagagagcgctgtcctccaggtgagaggacgttgtgc
tggtgtaggcctttcttaaattgcgggtggatgctaatgatgtcctctcttggtttacag
AAAGGTTTTACACCCCTGTACATGGCAGCACAAGAGAACCACTTGGAAGTGGTTAAGTTT
TTACTGGAAAATGGAGCTAACCAGAATGTAGCCACAGAA
gtaagtaccttggaaaaatgtcgtcaccaccagaagtctcccaggtgtacaaccttgctt
caggtgacacctacctgggatgtggcttggggtgcatccatgtcatgatggatgaccttc
aggtcgctgcactaatccagagtgctgtcaggttctgcaagggactaatgacaaagtcat
EXON 6  186 bp
gggcttcagggaggagatggcatttaggctaaacttggcggatgaagagggctttggtgg
aggtaggtccctcaggctggggctgctgggagcataagcccgaggggcaagggtgtgtcc
cgtgtgaagggcggctggcgtcagacgagtcagagcaaagcattttcctcctctggccag
GACGGCTTCACGCCTCTGGCGGTAGCCCTGCAGCAGGGCCATGAGAACGTCGTCGCGCAC
CTCATCAACTACGGCACCAAGGGGAAGGTGCGCCTCCCGGCCCTGCACATCGCGGCCCGC
AACGACGACACGCGCACGGCTGCGGTGCTGCTGCAGAACGACCCCAACCCGGACGTGCTT
TCCAAG
gtgagggcgaggaggagggaggagccttgggccgcggacgcccgtgggctcagggggcac
cgcgcacgcccagcgacttcccaggcaggagaaccgagcgtgcagggcgggcagtgcgca
ctgagcgccctcaccccaggacgcagaggggcccctggacagccccgctctaaatccctg
EXON 7  99 bp
ttttgaatacactgtgccataaagcctctcttgaccccctcaccaaatgttcccacccat
caaaatctcctttgtctgtaaagtcctgttgccccacctgagtttcctgcatcccagggc
tgattctgagatagaagtaaatcacatataacaagtttctccccctctgttgtgccccag
ACGGGATTCACGCCCCTGCACATTGCGGCTCACTACGAGAACCTCAACGTGGCCCAGTTG
CTCCTCAACAGAGGAGCCAGCGTCAATTTCACACCACAG
gtaaccctggggcacgtgcgccctcactgtccgggggcttggggctggcagttgctcctg
cctcggcaccatgggtttcatcccagtggcagaagtgcctgtgggttaaacagccctgct
gtctggtcgggctccttgctggcaggtttctgatcatctaccccccagtttccacctgct
EXON 8  99 bp
cgtctcaaaaaaaaaaaaaaataaaaaataaaaaaaaataaaatatcttaggccagaaat
gccctgacaacgctgttgcaggcctggggactgggggctggggacaaggggagcgggtgc
acagcagctgcattccagggaaggatgacgcgccctgaccgtcctgcttcctcccttcag
AACGGCATCACGCCACTGCACATCGCCTCCCGCAGGGGCAACGTGATCATGGTGCGGCTG
CTGCTGGATCGGGGAGCCCAGATAGAAACCAAGACCAAG
gtgggtgccagcaggtgctgtagccaggcagggggagggaggtcccccctcacaagcctc
acccagagcagcgggcccttggtgacctagttagggatgcaccaccagcctcccggagcc
gcctgcagcagtattctgggcagtgccgcgtgcagtgggaggcaatagtaaaactgtgct
EXON 9  99 bp
tattctgggcagtgccgcgtgcagtgggaggcaatagtaaaactgtgctgaggtcgagct
ggtgcttgaggaaacgtcagcacttgcgtgggctgggatgatgccataggcagtcttctc
tccaaatggcctctgatagctgccttttgggctttctgtttttgactctgtcttttaaag
GACGAATTGACACCTCTCCACTGTGCAGCTCGAAATGGGCACGTGCGAATCTCAGAGATC
CTGCTGGACCACGGGGCACCAATCCAAGCCAAAACCAAG
gtgtgtacttccttcctgtcaggcgcattttctagacagggctccaggtccaacagacct
ggcatcaaatcctatttctgtaaaacagagatgctaatactactagatgagatagcacct
ttgacatttattacaaggcctatcacgtaggagactctcagtgtagctctaatgcctaac
EXON 10  198 bp
agaatgtctgtggtcagagaccggcaggagcgtggaggccagggtgagccaagctccctc
cagagacttgtggaaacattgtgtagggaagaagtagggagtgacgttggaatcgtcctg
aatctccatgctcggtccccagaagactttgtgattgcttgtgttttcctctttacccag
AACGGCCTGTCCCCAATTCACATGGCGGCTCAGGGAGACCACCTCGACTGTGTCCGGCTC
CTGTTGCAATACGACGCAGAGATAGACGACATCACCCTGGACCACCTGACCCCACTCCAC
GTGGCTGCCCACTGTGGACACCACAGGGTGGCTAAGGTCCTTCTGGATAAAGGGGCCAAA
CCCAACTCCAGAGCCCTG
gtgagtgggggtgctgctggagaaggtgcagagtggcagggcaggctgggggcaggagca
gagaggcatggctgggcctgtgggaagggcggcaggtgcccggagctccccagattcgag
gcctgagcagtggggtgtgacagcactggatggtgggggcctggtgtgcacccctcctgc
EXON 11  99 bp
atttgcattaattgacattataagactaatcaattggcattaattcgttgattggtctat
gggcatctgctggtggcctgggcagcagctgccttttagagcagccaggtggtcttctgg
gcgttccttgggcccgtgtgtaagctcctgcttgtctgtctccctttgtgtgggctgcag
AATGGCTTTACCCCCTTACACATCGCCTGCAAAAAGAACCACGTCCGTGTCATGGAGCTG
CTGCTGAAGACGGGAGCCTCGATCGACGCGGTCACCGAG
gtaggagagactgcagaggagcctgggggcaggcctgtggtctcccccgacccaccttct
ccaagagtcgctctttgtagctttgtatggctgcaggggtgtgtgtgtctgcaagtctgg
actgctggaaggaatgaatcaggggtgactaagacaagggaacatgagtcaagtctcatg
EXON 12  99 bp
gggcacgacttgcccacagtaatttttttctccaaccattttcttggaagcaaacccacc
tcatatagctcccttttcttggaaaatcatttgtgaaagcgttagatactgtcaggttct
ctcttcttcaggggagcggaaagactcccacttatcggactctgcctttgtctgtttcag
TCTGGCCTGACACCTCTCCACGTGGCCTCCTTCATGGGGCACCTTCCCATCGTGAAGAAC
CTCCTGCAGCGGGGGGCGTCGCCCAACGTCTCCAACGTG
gtaagccctcaggcaggcaggggcttgctcccctagaccaagagctcagagggcagcttt
caccagtgctcccagtcctactctctggggacagagctacgattcccagaacagccaatg
cttcagactgggggaggacatccctgtgtactgacgctttctggattaaatttctcacac
EXON 13  99 bp
cacacatacatgctcatgcacacatgcacacataccaggctaaagagctgcctgctgggg
caactccacctcttggacaaaaacccaccaagccactccagactgcacttcctagctctg
tgtgtgccgttttggacagcaggcatgtatgaacagttctataattttgttattttatag
AAAGTGGAGACCCCGCTACACATGGCAGCCAGAGCCGGGCACACGGAAGTGGCCAAATAT
TTACTCCAGAACAAAGCCAAAGTCAATGCCAAGGCCAAG
gtgagtagtgaaggcaggaagggaagggtttcagatgtgagcagttccagcactgtgcag
agaacccatcctcattccaggcggggctgcagtgctgtggcctggggatcacttttcatc
ctgatcaggtcactctgagcgcccagattctgctttgcagggggtttgagaagaccaggg
EXON 14  198 bp
gcatattggttcctgtaactcagagacttgattcgaatcctgactcttcatcttcttagc
tgtgtgaccttgagaaggtcacttgccctctctgggccctgccttgcttctctgtaagat
gaaaagttggatttggtaacattagcgtttcttcttctttgttttcccttcggggtccag
GATGACCAGACCCCACTTCACTGTGCAGCTCGCATCGGCCACACAAACATGGTGAAGCTC
CTGCTGGAAAATAACGCCAACCCCAACCTGGCCACCACCGCCGGGCACACCCCCCTGCAC
ATTGCAGCCCGTGAGGGCCATGTGGAAACAGTCCTGGCCCTTCTGGAAAAGGAAGCATCC
CAGGCCTGCATGACCAAG
gtacagcctcccgcctcgtggtctaaggaagcaacaggctcactcagccaggcctggagc
tcggaggggaattcctgcctggttctctttgtcacctcaatgatgctgcaagcagctgga
agggtcgtcacactcagggctggccaccacctgcaagccgatgtgtctccatccttcccc
EXON 15  99 bp
tgcagggatgcctgccaagtcctgaggtcttcggcctcccagagggctcaaaaatggctg
tgcctttgctttcattggcctctccatgccagcggaggtgcagcctcctttgctgtgggc
cctttctccagggaggacagccctggggccccaaggtcctgacagcctgtttctcctcag
AAAGGATTTACCCCTCTGCACGTGGCGGCCAAGTACGGGAAGGTGCGGGTGGCAGAGCTG
CTGCTGGAGCGGGACGCACACCCGAATGCTGCCGGAAAA
gtgagtttgaaccctgccctcccctgcagctctcaggttagaggcaaggacagaggatgg
acatcagcacttgcagattccatctcttgcctgtgttgttcatcttttttttctttgaga
cagggtctcgctctgttgcccaggctggagtgcagtggtgccatcacaactcactacaat
EXON 16  99 bp
tcccacagggctctgggtcctgccgatgacattctgtcatgactccaagttaagactggc
ctgggaaagattttaaacaggattttactgtataaaataggtgctcccatgcctaaaggg
agtcctgggagaaagtccgtgggagtgacagccggcctcttttgtctttgtcccctgcag
AATGGCCTGACCCCCCTGCACGTGGCCGTCCATCACAACAACCTGGACATCGTCAAGCTG
CTGCTTCCCCGGGGCGGCTCCCCGCACAGCCCTGCCTGG
gtaaggcccgcccctctccccagctgcccctggagagcaggtcacctgctaccttccagt
ccctcagggaggggggtttccacagcagcccaagggttttgcgttctgttgctattttta
cctcagaaatcacgcctcactttcccacatgttacctgccctgtaatcacgctattcagg
EXON 17  198 bp
gtctccaaatcaaatggattttgtttgtttgtttgtttacctaaattgctcctgggtgat
gccagccctgctcactgggtgtccagccggccaagaaccagactcagcccctgcttgtgt
gttgatattgtcagctcagcattcctgtaaccaggctctgggcggcttcttctgtttcag
AATGGCTACACCCCTTTGCACATCGCTGCCAAGCAGAACCAGGTGGAGGTGGCCCGTAGT
CTGCTGCAGTATGGGGGCTCAGCAAACGCCGAGTCGGTGCAAGGTGTGACGCCCCTTCAC
CTGGCCGCCCAGGAGGGCCACGCAGAGATGGTGGCTCTGCTGCTCTCGAAACAAGCCAAT
GGCAACCTGGGGAACAAG
gtaggcatggtgtcttcggatctgccctggagtgctggataacaacgtgtggtgtcttca
tattgagcatctatgtgtgcccaggttctgagttaggggtgtgtgtgtgtaatccttgga
acagccctgcgtacatttcaccttcattttataaatgaataaacagagtcagaaaggttg
EXON 18  99 bp
gtaaccaccttactttttagataaggacattggggcccagaacaggaagagctttgcctg
gagccaaataactagttggtgactgcaaagttagcttcagctcccagacctcagagctct
ttacttgtggcctggaattctttacttgatagaaggtgatgaacgtctttttctttgcag
AGCGGACTCACTCCCCTCCATCTGGTAGCACAAGAAGGCCACGTTCCAGTGGCAGATGTG
CTGATCAAACACGGCGTCATGGTGGACGCCACCACCCGG
gtaaggcaggcagccggaacttcagtctgtgtggactccttgctcacacttcagaattga
atcttccacagagctttgaaaccccaaagacccagtgggacattcttctctgccacttcc
tagggctggcagtggagtttgaaaacactactcctaattacctgactttcccattgggga
EXON 19  99 bp
ggtctcccacaagcatctcagcctggtggtctctgcccagcagcagccattcagcttgtc
aatgtcagccttcaaggggctccctgtccgttctctctttgaatcagctgctttgggaag
gatttcatgtgatgcccagctcaggacagctccggtcactccttctcatctgcttttcag
ATGGGCTACACTCCCCTCCATGTGGCCAGTCACTATGGAAACATCAAGCTGGTGAAGTTT
CTGCTGCAGCACCAGGCAGATGTCAATGCCAAGACCAAG
gtacaggggtgccccagccccgactcctgcactgacccttctccatgccacatcagggta
aagccagagctgctctgggagcactagggttttgaccatggaccctgaaggaagaaaggg
ggaaaatgcatttcattaatgtcccacttcgaagatgggcaggcactatcatgtgtaggc
EXON 20  99 bp
agggtaaagccagagctgctctgggagcactagggttttgaccatggaccctgaaggaag
aaagggggaaaatgcatttcattaatgtcccacttcgaagatgggcaggcactatcatgt
gtaggcaggtctctgtctagtggctggctaaccctgcctaaatgtctgctcactttgcag
CTAGGATACAGCCCCCTGCACCAGGCAGCCCAGCAGGGACACACAGACATCGTGACTCTG
CTTCTGAAAAACGGTGCTTCCCCAAACGAGGTCAGCTCG
gtgagtacactctctctcctgagtttagaaaactgctccccatggcagcagccctgtgtg
aactcccctaaccgtagaggttaatgcacgtgtctagggcctggacggggccgcagcacc
ctaaagccacagctaccttgggtaccctggggatggggtgctgtgatcagttcctctttc
EXON 21  93 bp
gctaacacacatctaggcacacacacgtgcagggatctctttctgggccccacggtgacg
tctgtccactcaggtcctcctgaacaactagaaggtgaactcgatctgtgtctagggagc
cagccccgcctcctagactccatcccctgtctgactgcacccgggctgctctttccccag
GATGGAACCACACCTCTGGCCATAGCCAAGCGCTTGGGCTACATTTCTGTCACCGACGTG
CTCAAGGTCGTCACGGATGAAACCAGTTTCGTG
gtatgtctgcctctcccccgcacccaccccagacacactcagcctggcgcacaggcgtgc
ctggggttactctggaagtggggtgcgttctggggctccgggacgcgggtcggaggcgcc
gcgcccgacgggtgggagcttgtcctccttccagcggggctgtgctgccacctagcggcc
EXON 22  73 bp
cagttttcccgggtcccgtccccgtggttcctgcccggcagcttccaggctgagcgcctc
ctccgtctgtttttcttcatttgtgggaaaccccacaggcatgaccagggaaccgctggg
ctggtaaaaaatgtgtgcggctctagtttgggttgaattatctgctttttctcgttttag
TTAGTCAGTGATAAGCATCGAATGAGTTTCCCTGAGACAGTTGATGAGATCCTGGATGTC
TCGGAAGATGAAG
gtaacgttggggtaaagagctcaggctggtggggacagaggggctccgggcaccctccaa
gggggcttcctgccacctgccggctttgtccccttacaacacgcccaagcactatagatg
gacactgaaactggggagacctggtttttataactgttgtctactatcaaaaatactgct
EXON 23  97 bp
cccagagctggaggaccaggactgggcaaagacattgctcccagtctccttgcagcatca
agaccttccccactcctcaggagcaagcccccagaggcggagcgggaacagagctttttt
aaaaaaagagggactcttcttcctctaccccgtcgctcacttgagctcttgctgtttcag
GGGAAGAACTCATCAGCTTCAAGGCTGAGAGGCGGGATTCCAGGGATGTTGATGAAGAGA
AGGAGCTGCTGGATTTTGTGCCGAAGCTAGACCAAGT
gtgagcagtgctcccgggagggtccccgggggtgccgagatgcaaccctgtggctcagag
cagggattccagagggaggaaggacacagcaggccaggcgctgggctcgctgcccgcaga
gagagacggtttgcaccttaggatgagctagctctgcaccctagccactagggcaggcgg
EXON 24  79 bp
tgcaggttggagtcattggggaggacttcatggaggaggaggcggtccttccaccaggtt
gtgaagcgcagtcaggctctggagtggaaagccggagggagaggcttggaggcaagagga
agaggagctgtgtgcacatgtggatcagccctgtgatgttctggtgttcttggcacgcag
GGTGGAATCTCCAGCCATCCCCAGGATTCCCTGTGCCATGCCTGAGACAGTGGTGATCAG
GTCAGAAGAGCAGGAGCAG
gtgagaagctccttctctgtggtttccccacatggagggcatgaaaaccctgggacagtg
attgttgaggggtggcctgtacgtagcacaataggcactaatagctcacatgccactcac
tgtccaactggcattccacgcttggacgcctcataatggtgcaacattggtggcgctggg
EXON 25  98 bp
tgcttccttttagacctcaggacggccttgtctgacagggcggtggggtcccgtgggagc
actttctccacgtggcacctggtttctagcggcaaggttcttccaagcctccacgccctg
gcacggcatccagctggcccgggaggaggtgggacaggaggaccctttctctctcctcag
GCATCTAAAGAGTATGATGAGGACTCCCTCATCCCCAGCAGCCCGGCCACCGAGACCTCA
GACAACATCAGCCCGGTGGCCAGCCCGGTGCATACAGG
gtgagtggcgggcgcagggctcggggactcctgtctccatctccgagaggggatgcagaa
gcccaacgtgcatctgccccactcctaggtttctggtgagcttcatggttgacgcccggg
gtggttccatgagaggaagtcgccacaacggcctgcgagtggtgatcccgccacggacgt
EXON 26  225 bp
aaagagtatgatgaggactccctcatccccagcagcccggccaccgagacctcagacaac
atcagcccggtggccagcccggtgcatacagggtgagtggcgggcgcagggctcggggac
tcctgtctccatctccgagaggggatgcagaagcccaacgtgcatctgccccactcctag
GTTTCTGGTGAGCTTCATGGTTGACGCCCGGGGTGGTTCCATGAGAGGAAGTCGCCACAA
CGGCCTGCGAGTGGTGATCCCGCCACGGACGTGCGCAGCGCCCACCCGCATCACCTGCCG
CCTGGTCAAGCCCCAGAAGCTCAGCACGCCGCCCCCACTGGCCGAGGAGGAGGGCCTGGC
CAGCAGGATCATAGCACTGGGGCCCACGGGGGCACAGTTCCTGAG
gtgagcttgcgcgggcagcccgtgttctcccctgtccctgtgccacggaggccacgccat
ttccatctgtcctgatggggaaacagaactgggtgcccctcccctttccctgacttttcc
tgacacacgaaggtgtccatagccctgagagggcttacaactctcagatctcaggtcggg
EXON 27  155 bp
gaagccctggggaacctccccatgggtctggtccacttagagacctgcctgcaggtgggg
cctccacgtggctgcggaagtgccttatccatctgggtgggagccggcagccccatccct
ccctgtgccctgcctgccttgtatgagcacctccccaccaccactgtgtccttgcctcag
CCCTGTAATCGTGGAGATCCCGCACTTTGCCTCCCATGGCCGTGGAGACCGCGAGCTCGT
GGTTCTGAGGAGCGAAAACGGCTCCGTGTGGAAGGAGCACAGGAGCCGCTATGGAGAGAG
CTACCTGGATCAGATCCTCAACGGGATGGACGAAG
gtaggggcgggggatcccagggctgggtcccctccttgcggaagaggggtttgagttgca
ccttaaaggtggtctttgagggccacctgaagtttgggaagccccaagaggctgagaatg
gcctggtgtggacaagccctgggtccccaggatgtgtgagaggatgctcagcggctgcct
EXON 28  212 bp
ctctgctgggcctctgggcctgggcacttcttctggccacttcttctggccactatgccg
cccggcacctggggagggtgtgtgcactgggtcttggggacaaggagactctggggcccc
tggaagtcctgaacctgtgcctgatgtgaccggggtggtggcctgtgtgtgtgattccag
AGCTGGGGAGCCTGGAGGAGCTAGAGAAGAAGAGGGTGTGCCGAATCATCACCACCGACT
TCCCGCTGTACTTCGTGATCATGTCACGGCTCTGCCAGGACTACGACACCATCGGTCCCG
AAGGGGGCTCCCTGAAGAGCAAGCTGGTGCCCCTGGTACAGGCAACGTTCCCGGAGAATG
CCGTCACCAAGAGAGTGAAGCTGGCTCTGCAG
gtgacagccctcctccccgccaggtcctgggggtggactgaactccaggcctccgggaag
gccaccctcttccccaggacatccccacacttttgtctggtgctttgaaatgccacagtg
gagatctgagtttaaagctcaaaggagagttaagtgggaaggggtgaggtggaagctccc
EXON 29  205 bp
gcagaggagaaggggagaaagggctcaggaaggcaagctccaccgtgtcggttctgtggt
ccaacagcagggcgggaccccgtgcactgacggccactctcaccaggcatggagctgcct
cccgtctgattagcccctctcctgcttgggcctgagtgtcctgcctctgtcatttcacag
GCCCAGCCTGTCCCGGATGAGCTTGTCACTAAGCTCCTGGGCAACCAGGCCACATTCAGC
CCCATTGTCACCGTGGAGCCCCGGCGCCGGAAGTTCCACCGCCCCATTGGGCTTCGGATC
CCACTACCTCCTTCCTGGACCGACAACCCGAGGGACAGCGGGGAGGGAGACACCACCAGC
CTGCGCCTGCTTTGCAGCGTCATTG
gtgagaggggcccctgcctcgcttctgttctcggctgctgcagtgcgtctggaacacagt
aggggggtgactcgagaaggcgaggccagcaatccccttagtttttgttgacttccccgg
gagtgaggtgctcttccaagagatggaaggatgatgtatctgcataaaagtccatgccca
EXON 30  97 bp
gaggaggggcatgcaggttgctaggaggaagagcagcggggtgagggtagggtgcccagg
gctgcagacaaagtgagcttcacccagtctcaccttgcacaccacggccttagcatttta
gtaagctccatgcttacatcctgaagactgtccccagccccatttctgccgctgttacag
GAGGAACAGACCAAGCCCAGTGGGAAGACATAACAGGAACCACCAAACTTGTATATGCCA
ACGAGTGCGCCAACTTCACCACCAATGTCTCTGCCAG
gtgagacgaggccagcccagcccagtattgtgtgggccgtcctcaggctctatgctgccg
tccaggcctgaggctgaggctccctcactgtcccctccatgtggaagcctccgtgaccac
aggtgtggcaatagtagccatggtatggctcacgggctgctcccgtctggatggaaagga
EXON 31  229 bp
tctatgctgccgtccaggcctgaggctgaggctccctcactgtcccctccatgtggaagc
ctccgtgaccacaggtgtggcaatagtagccatggtatggctcacgggctgctcccgtct
ggatggaaaggatgctctctgttgggcacttgggaacacataactcgccctactttttag
GTTTTGGCTGTCGGACTGTCCTCGGACTGCTGAGGCTGTGAACTTTGCCACCCTGCTGTA
CAAAGAGCTCACTGCAGTGCCCTACATGGCCAAATTCGTCATCTTTGCCAAGATGAATGA
CCCCCGAGAGGGGCGCCTGCGCTGCTACTGCATGACAGATGATAAAGTGGACAAGACCCT
GGAGCAGCATGAGAACTTCGTGGAGGTGGCCCGGAGCAGGGACATAGAG
gtaacagggctgggccctgcaccgcctctgggacaaaccgtcctgccgttttctccagaa
caccattaccaggtgcaggcaggcagtcctccctctgtagacgaggggctccacagctgt
ctgtctttgagacccctcttgagaagcatcttagagaagcttcaggaaaggagagagatg
EXON 32  126 bp
ttgatcacaattttggaaataaagcctttcccaaaacaaacagtggatttctcagcacac
acccgcatgcctcttgctgaggcagggtgtgtcttggagagggaaggaccgaaggtggaa
ggagggacatctgggcccttctctccctgacaagctgtatctgcttttcctctcctgcag
GTGTTGGAAGGAATGTCCCTGTTTGCAGAACTCTCTGGGAACCTGGTGCCTGTGAAGAAA
GCTGCCCAGCAGCGGAGCTTCCACTTCCAGTCATTTCGGGAGAACCGTCTGGCCATGCCT
GTAAAG
gtgccggcaccctctggctgagttctcctctgggtctagaaagttggggaggcagaattc
cctaaaccagacagccgggtggcctagaaaagggcccctgaattctcctttgtgtgattg
agtttaggtgagggacagcagtcgagagccgggagggtccctgtcgtttctgcgcaaggc
EXON 33  120 bp
ggagcttccacttccagtcatttcgggagaaccgtctggccatgcctgtaaaggtgccgg
caccctctggctgagttctcctctgggtctagaaagttggggaggcagaattccctaaac
cagacagccgggtggcctagaaaagggcccctgaattctcctttgtgtgattgagtttag
GTGAGGGACAGCAGTCGAGAGCCGGGAGGGTCCCTGTCGTTTCTGCGCAAGGCGATGAAG
TACGAGGACACCCAGCACATTCTCTGCCACCTGAACATCACCATGCCCCCCTGCGCCAAG

gtgagctggcacctgccgaggagccttggcccgagacggcttccctgtaggaggtcccca
aacagaccccaggtccagcacttccaaggggcttcttcctggtggaagcttagagtcccc
cgaggcatgcaaaggtgctgagctctcctccacatgctcatgttgtggcctggcggggag
EXON 34  79 bp
tcccttcactcccactcctcccatgtgttactctttgtgttaagtccctgaagaaacgga
ctgattgtttaccaggactggggtcagccttccacacccctgcagcataggagctcagat
cactttctctgggaaggtggggagagtccaaaacccaaagcaccctttcttcttctgcag
GGAAGTGGAGCCGAAGATAGGAGAAGGACCCCGACGCCCCTGGCCCTGCGATACAGCATT
CTCAGTGAGTCCACACCAG
gtacggcctctgtgtgatgatgcatgcttgctcccttcccaagaagggtgggcgtgagct
catctccccgcagccctgtgagggttctgctgaggtgccgctcgctcagccagttccaaa
agcagctgcagagctgactcgggtcttcccctgatcttgcagagagtctagacaatcacc
EXON 35  75 bp
ctcgctcagccagttccaaaagcagctgcagagctgactcgggtcttcccctgatcttgc
agagagtctagacaatcaccccagtgcacacggaagccacatccatcacaggccgtgtcc
tcaggcctgtcaactgtgtcctgccctggctactaaatgaaatctaatgcttctccccag
GTTCTCTCAGTGGGACAGAGCAGGCAGAGATGAAGATGGCTGTTATCTCAGAGCACCTCG
GTCTCAGCTGGGCAG
gtgagtggggaattgggggcagaaaagcactttgtccatctcacctaccctcttcccctg
taatgagcaatgaatgaggcatttctaaccctccttttatcacccgtgggttatctgatt
tgtgattgtctgagctgggtctgctgcccaagccacaccattggctgcccatgaaggggg
EXON 36  132 bp
atttcataaggaatttcttgataagaaggaagaccaaacccacagggaggctgcctcaga
gctccctgtgctccccactgggtccccccacgccccagtgcccacccagcctgtgtgctg
gaggccccctgctgttggtgagctggaggctcacatctgctgttggttctttgcttgcag
AGTTGGCCCGGGAGCTGCAGTTCAGTGTGGAAGACATCAACAGGATCCGAGTGGAAAATC
CCAACTCCCTGTTGGAGCAGAGTGTGGCCTTGCTGAACCTCTGGGTCATCCGTGAAGGCC
AAAACGCAAACA
gtcagtaccgtcccactgaggaagcctgtcctaggacctcctccccaccaaactagttct
tccttcaaattccattcatgacactggcctctggagtcagtctgtctctgtctctctcac
acacactcacgcaccactcgcatcaggaggtcttccaggcagtcctgccagaaggcatga
EXON 37  147 bp
gaagtgtaaaaagtattctccccagaggaagtttgttttgactctaataaaagagggtgc
ctccaccttctgaaaaaaattatctcctttctccatcttcatcctggccccattttctga
gcccatgtgatcctcgctcaccggcctggagtaacgtgcatctctcttctgcgcccacag
TGGAGAATCTGTACACAGCCCTGCAGAGCATTGACCGTGGCGAGATCGTGAACATGCTGG
AGGGTTCCGGCCGACAGAGCCGCAACTTGAAGCCAGACAGGCGGCACACCGACCGCGACT
ACTCGCTGTCACCCTCCCAGATGAATG
gtgagtgtcacctggaccagatggggactgagccggagccctgccctacaggcatcagca
ccaataaccccttcccacaatacgtcatccctcaaagcccgctctgcctcccattggtgg
gaggtctggtttgtcagcaacaagttcctcctttccggggaagcagaggcgaaggagaga
EXON 38  559 bp
cagccacaaggcctgagcattgggcctggagcttggaaagcccccaacccaccccgaatg
tgcatgcatctctgtggccgcacccgcatgtgtgtgttcgtgcgtgtgcgtggacctgca
cgtgaatgggtgggacaggaatcactgctggagcatgttgccctctgtctgcccatccag
GTTACTCCTCACTGCAGGACGAGCTGCTGTCCCCTGCCTCCCTGGGCTGTGCACTTTCCT
CTCCGCTACGTGCAGACCAGTACTGGAATGAGGTGGCCGTCCTAGACGCCATCCCCTTGG
CGGCCACGGAGCATGACACCATGCTGGAGATGTCTGACATGCAGGTGTGGTCTGCGGGCC
TCACGCCTTCTCTGGTCACTGCTGAGGACTCCTCTCTGGAGTGTAGCAAGGCTGAGGACT
CTGATGCCACAGGTCACGAGTGGAAGTTGGAGGGGGCACTCTCAGAGGAACCGCGGGGCC
CCGAGTTGGGCTCTCTGGAACTTGTGGAGGACGACACAGTGGATTCAGATGCCACAAATG
GCCTTATCGATTTGCTTGAACAGGAGGAAGGTCAGAGGTCAGAAGAGAAGCTGCCAGGTT
CTAAGAGGCAGGATGACGCGACAGGTGCAGGGCAGGACTCAGAGAATGAAGTGTCTCTTG
TTTCAGGCCATCAGAGGGGGCAAGCCCGAATCACACATTCCCCCACCGTGAGTCAGGTGA
CGGAGAGGAGTCAGGACAG
gtaagagcttgactgtgggagcagggtccctttttgtcttctgggctcctgggtaagatt
atgcctggcagtgaggacagaggtgtcgatgccaaccctgaccctgggttctaattgcac
aggagcacatacattcagtctggcagatgccatatataagagcataggtgccatctgcaa
EXON 39  298 bp
agtgaggtgagcaatgtgctcatgcgcccctgacctttggagggatgggaggacggtctg
tgtccttgatgagccagagctctgggtggggagagtgtctaaaaggaatgagactgatgg
gtgaccaggtgtcttttctctctccccggccggccatctgctgcttcttctggaccccag
ACTGCAGGACTGGGATGCAGACGGCTCGATTGTCTCATACCTGCAAGATGCTGCACAAGG
TTCCTGGCAAGAGGAGGTCACGCAAGGTCCACACTCATTCCAGGGAACAAGTACCATGAC
TGAAGGGCTAGAGCCCGGTGGATCTCAGGAGTACGAGAAGGTCCTGGTGTCTGTAAGTGA
GCACACGTGGACAGAACAGCCCGAGGCTGAGAGCTCCCAGGCCGACAGGGACCGGAGGCA
GCAAGGCCAAGAAGAGCAGGTGCAGGAGGCCAAGAACACCTTCACCCAAGTGGTGCAG
gtgagagcccgaggggagctgcgtgctgctgttccttcccagcatcggaaggggccggga
ctccagggctgcctctcaggcactcaagccctgagctaagcatatccccttcctttaaca
cttgtggtggtgcttccgtttctctagaagtcaagggcaaggcctgcctttctgcctcct
EXON 40  84 bp
gccgcccacgccctgggagccctggcatggctcctgctacatgctgagccgggtttcctg
ctgggggagttattgggccatggctattgtggctactgctgtttcatttcctcgtcctcc
acccttcctcccagactcccactcaccaatcttgcattttctccctttctctaattccag
GGGAATGAGTTTCAGAATATTCCAGGGGAGCAGGTGACAGAGGAGCAATTCACGGATGAG
CAGGGCAACATTGTCACCAAGAAG
gtgggtgcagagtgttcccctctgtgctggggagaggcaggtgggctagaagctaaaagg
tggtagaagccagtggcttctccctgctgccctcacagcaggtgagcacagccaggctgg
ctgcccccgtgctcaggagggatggagggcccaggagctgggagctttggtcatctgcag
EXON 41  66 bp
ccacaccgggctaatttttgtatttttagtagagacagggtttcaccatgttggccaggc
tggtctcaaactcctgacctcagatgatctgcacgtcagcctcccaaagtgctgagatta
cagacatgagcccccgagcccggcctgaccagccctttcctccttcccttcctttcctag
ATCATTCGCAAGGTGGTTCGACAGATAGACTTGTCCAGCGCCGATGCCGCCCAGGAGCAC
GAGGAG
gtgactgtagaggggcccctggaggatcccagtgagctggaggtcgatattgattacttt
atgaaacactccaaggtactgaggcgcccgcggccctgggggacccagcgccatcactgc
tgccttgctctgccgggccgtctgcatgacacctccctccactcacctctttatgagctc
EXON 42  135 bp
gccgggccgtctgcatgacacctccctccactcacctctttatgagctctctctccagtc
tctcttctccctggtgggcagtgtgtctgccacctccgtgtggcctcctttcgatcttct
gcctgtgttctgcccgtctttgcgatctgtcctgctttctgtctctgctgctgtctgcag
GTGGAGCTGAGAGGGAGTGGCCTACAGCCGGACCTGATAGAGGGCAGGAAGGGGGCGCAG
ATAGTGAAGCGGGCCAGCCTGAAAAGGGGGAAACAGTGACCCCGAGCCGCTCTCCTTGGA
GTAGCCTCTCGGGAG
gtaacgctgcccttctcatcccctctgcatggcctggtcttcagtggagtggctgctccc
tgtctcaccctatcccctcccagccaccccagcatgatgtgggacaaacaacttgttgtt
gtgtctcgaggcagagattctcacttcccaaccctgctaacagttggctctgaaccccag
EXON 43  2529 bp
gcatctcaggaagtcgggctgcaagtgcagcaccctcagcacatcgccctgcctggggag
actgcttttcctgagtcagattcggcctgagctgccagcacaaaactctgtgtgtggggt
ttttgctggacgttgcacttttgcattctaagtgactccttctctctttgtgtctcccag
GATCACACCTCGACACCCAACCCCTGAACCCCACACACTCTGCCATGCACACAGGAGGAG
AGCTGGACCTGAGGGCCACCGCAGCGGTGCACACATTCCTCTGGGCTGACGGCATGACCT
CTGTAAGGGACTCCTGCTAGTCCCCTCTTGGCATGAATGACTGACTGTAGACGCATGACC
TCCAGGCTTCAATCCTGCCTCTTGCAATGACAGCTGATCTGTCGGAACCAGGACACAAAA
GCAGCAAGAAGCGGGGAGAGAGAGGGATAGAAAACAAGCGCAGGAGAGCCTGCGAACGCA
AAAGTGAATGAGGGCTTTTTGTGGCTGGGGATGGGTTTTGGTTTTGGGGTTTTTTTTTTA
AATTGTTTTGACTTCGTACAGGGTACTTTTTCCCAACCTCATCTGTCAGAAATCCATGTG
GGCTTCCTGGAAAGAAAAAAAAAAAAAAGAAAACTAGGCATGAAATCAGTTTAACACCTT
AATCTTAAGCCATGTCCTCATCTGCCCACCCTCCCCAACCCACATACCTCCATTCCACTT
GTGACACCCCCTCGACTCCCTGGTGACGCTCCTCCCAGATCGCTCTACATGACATTCAGG
ACACACACACACACACACACACACCACTCGCCTCCACTGAATCTACACACAGATTTTACT
GTGACTTCTGAAGCTGTATAGACTCTGCTGTGGATAAATTGGAATTTTTTATGTTGTCTC
TCTCTCTGCCAATTTCAATACGAATCATCTTCCAATGGAAAATCATTACCTTGAAGAGTG
CATTCGGGGTTCCTTGTGTTAGGGACTTAAGAATCTGAGGCGAGGACCCCCAGGCTTACC
TGTAGGACTCAAAGGGAGCCAGGACCCCATCTGAAAGGGTCTCCTCTCTCAGTTGGGGGA
CAGGCCGGTGGCTGACCCAGGATTGCACCAGCATGTCCATAGAGAAGAGGTTTTCTATGT
CTTCAAGCACTATATCATAGTCCGTGTTCAAAGTGTAAACTGTACAGTAATCAGCCTTGT
GTATATGAAAAACAATAAATACTATGCAAACCAATAGAAACATTTAGCAGTACGTACAGA
GCCTGACAGCGCAGCTCCTGAGGACTTCTGCGGCTGCAGGAGAAGGAGCTGTGGCCTGTC
TTTCAGTGAAAGAGGAAGGAAAGGAGTAGGGCTAGTGAATGTATCTGCCAGGTCTTAGAA
GTCAGGACCACCCAGGGTCTCCCAGAGTGAACTTGGTGCTCTAAGTCCAGGCAGCCTGCA
GGCTGGGGACCCTGGGTGCAGGTGCCAGGCTCGAGGCTGTTCCCTGTCCTGCCTCAGTGC
CTCCCCTCTGCCCAGCCCCTGTGGCCTCTTGGAGAGGCGAGCCAGGGGGCTCCCCGGACC
GCATGGCCGGTGAGAGTAGAGTCGGAGGCGGAGAGCCTGGACGCCCAGAGGCCGGGGCCA
GGCTCTGGGTCAAGGCAGGAAGGAGACAGACAGCTGGCAGTTCCTCGCCTCGGTGCCATC
AGGGAGGAGCCTTAAGTTCCACTAGAGCCTCCGGCCCAGGGAGGCCAGAATCAGCACAAT
CCCGGCCCCGCCCTCGCGGCGGGCGCCCCCAGGGCCAGGAGAGAGAGACAGGGCTGGCTC
CTCTCGCCCCTGGAGCCGCGGTGTGGACGGCCCGGCCCCGTCCGCCCCGCCGCTCTGCGG
GAGTGTCCTCGGGACACACTTAAACCTTCCAAGTAGCACAGAAGCCCCCTCCACGTCAGA
GGCCCCCTGGCCGCGGGGCCTGTGAGCGGAGAGGGGCCCTGCTTCCCACACAAATCCGCC
CCGGTGCACCCCCGGCCAGGCAGGCCCCGGGGCGGCCTAGGCGCCTTGTCGGCCGGGGGT
GGGGCTGCTTTTGCTTCCTTTAGAGGGGCGGGCAGGGAGAGGAAGCTCTAGCTCCGGGCC
TGAGTTTCCCCGAGGCTGCGTCGGAGGAGCTGCAGGGCGAGCCCGGACGGCTGCCGTCTC
CGCCAGAGGCCACCCCGGCCCGGCCTCCAGGGCGCAGAGGCGCCCCCCTCCATCCTCCCC
CATCCCGGGGGCCACGGCAGGGGGGCCGCACAGCGCGGCTGGGACCGATTCGGTGACGGC
CCAAGGAAGCTGGGCTCAGGGCTCGCCTCTCCCGCCTCGATCCTGCACCTTCCTCTCCCA
GGTCGCTGCTGCAGCCAACCCAGTAGCCCCCTTAGCGCCCCCGCGGACCCCGCAGCTCCA
GACTCCGCTTTGGCACCTCTGCTCCGGCTGGCATGGCTGCACGCTCCGGCTGCTAGTAGG
AGCCGTTAGGGGAGGAGTTTGGGGTCTCCACACGATGCCTAGAGAATGCTGCAGTCTGCA
CATTAGACGCTTTTTAGAAGTTTTGAAATTACCTTGATTTTTTTAATTGTTATGAAAATG
GATCTTTTCTTGACTCTCCCACATGCTCTGTTATGGGAGAGAATCCCCTACCCTACTCTG
ATGTATAGACCATTCTCCCTTCACCAGCCGAACCAATGTCAAAATTAATAAAGAAATGGA
CTAATGGCA
cagggctctatctctccttcccgctcgtctttggggggttaggggtgctgaggccagcgt
aaagcctgggttgtgatgtgaaggagtctatgggtggggctcaggtcccagagagcccgc
caatgcccagtcctcccagaagcctggacaaccctttaatcaggaccacccacctgagag