--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (6506 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        396        453   0   Internal     58    92   Excellent
ttcgtccggggacccgcccgcgcgcggccggcggacgagactgcgcttcccaagcggctt
tgcggccgcggactccaagtcccagctgtgcccgggacgctgcgcgcccccgggactcca
tttcccagagtgccccgccccagcctcccggccccgccccccacctggctccgcgggcag
CCGGAGCGCACCCGGCCGGAAGCCGCTGTCGGGGAGCCGGCGGTGGGGCTGGACGCAG
gtgaggtggcaccggactcagccgcgccctgggccctggatgctccgtgagagtcaggga
gcgctgtgggggtctgggatcgaggggcatgggggcagcctggggctgtggtagagggtc
tggctgcggtgaggtctccccgcgtgcttgggagccgcgcgacgcctgcgcagggccccc

Exon  2 +       1204       1360   1   Internal    157    70        Good
agagctcccaggggaacagggctgcgacgagggagtgcctcggtccagctgggtctttct
ggttgccagtggactatgccccactctgagggcctcactctgtgccagttgccacagaag
agtggggctccaaaggatgagagcgtgatgacctcagcctcccactgtttgacattacag
GTGCAACTGACATGGGTGAACCCCAGGGATCCATGCGGATTCTAGTGACAGGGGGCTCTG
GGCTGGTAGGCAAAGCCATCCAGAAGGTGGTAGCAGATGGAGCTGGACTTCCTGGAGAGG
ACTGGGTGTTTGTCTCCTCTAAAGACGCCGATCTCAC
gtgagtgagcccatccccagatcagcccttcctctccatcctaccccccaccctagaact
aagagttccaggctgggcatgttgctgagtctaacagtagctgtgtttctgggtccttcc
tgccaggtggctggcctggcctgggtgtgcttggctgtgttcctggaaaaacaaacaccc

Exon  3 +       1707       1821   2   Internal    115    99   Excellent
aaaaacaaacaccctcccatctcttcctggaagcctgcaccctcatatcagccaggccct
ggggccaccctcccttttgactgtccctcctgccatagtcccacccagttcctgcacttg
gcacccaaccctggggtgctggttccctccagagcctcctgacagcctggcttcctacag
GGATACAGCACAGACCCGCGCCCTGTTTGAGAAGGTCCAACCCACACACGTCATCCATCT
TGCTGCAATGGTGGGGGGCCTGTTCCGGAATATCAAATACAATTTGGACTTCTGG
gtaagtgagggtggccccagcaagcactggaaaccaggatcccaggttctgggaacttcc
tggcgggcttcccactctcacaggcccacattcccaccccaggaagtccctgaggatcag
ggcttggcacagcctggtgggggcagcccctgagggacccccagtcactcacacttggtg

Exon  4 +       3012       3160   0   Internal    149   100   Excellent
gctggagagcaatggtgtctgtaagcccactgccttgtccggaaacggttaggatgggca
ggcttgggtcctcccagggctgaagggccagggtgtgtctccacttctgcgtctggagga
gcaggtaagggctgggatctggcctggggagcctgaactgtccccgcctcacccctgcag
AGGAAAAACGTGCACATGAACGACAACGTCCTGCACTCGGCCTTTGAGGTGGGCGCCCGC
AAGGTGGTGTCCTGCCTGTCCACCTGTATCTTCCCTGACAAGACGACCTACCCGATAGAT
GAGACCATGGTGAGGGGCAGGGCCTGGCT
gtgggtggggccggggagccggtgggcagggccaggaagtagcggcctctgcctctccca
cgcccgcagatccacaatgggcctccccacaacagcaattttgggtactcgtatgccaag
aggatgatcgacgtgcagaacaggtcctcgcgcccatcctgctgaggcccagccaggagt

Exon  5 +       3474       3615   2   Internal    142   100   Excellent
tgcagaacaggtcctcgcgcccatcctgctgaggcccagccaggagtcggggagagggcc
cccaggggcgggtggggccggctggtcgggtcttcgtgccagcctcagtaagaggccagc
ggcagcctggggtgggatcgcgggcccaggacgagggcaggagacgctgtgcctccgcag
GGCCTACTTCCAGCAGTACGGCTGCACCTTCACCGCTGTCATCCCCACCAACGTCTTCGG
GCCCCACGACAACTTCAACATCGAGGATGGCCACGTGCTGCCTGGCCTCATCCACAAGGT
GCACCTGGCCAAGAGTGAGTGC
gtccgtccgatggggtgcccgggctcagctcgggaggaggtgacccagtgcctctgacac
ctgctccttccccaaatctgcaggcagcggctcggccctgacggtgtggggtacagggaa
tccgcggaggcagttcatatactcgctggtgcgtaaaggaaggcacagctctccccagag

Exon  6 +       3699       3931   1   Terminal    233    50    Marginal
caccaacgtcttcgggccccacgacaacttcaacatcgaggatggccacgtgctgcctgg
cctcatccacaaggtgcacctggccaagagtgagtgcgtccgtccgatggggtgcccggg
ctcagctcgggaggaggtgacccagtgcctctgacacctgctccttccccaaatctgcag
GCAGCGGCTCGGCCCTGACGGTGTGGGGTACAGGGAATCCGCGGAGGCAGTTCATATACT
CGCTGGTGCGTAAAGGAAGGCACAGCTCTCCCCAGAGAACCTGCCCTATTGAGCCCTGGG
CTGGCCCCTGCTGGGCTGTCGGGGAGGTGGTGCAGGAGGGAGGCTCCTACCAGCAGAGAA
TCTGGGCTGAGCTCCAAGAGGAGCCATCTCTGGTCCTCGTGGAGGCCCCATAG
gctcctgtctccaggagtcactggcgtagctctgagctccaagggagaaaggagggaccc
ctgttccccaggctgagcccccactgaacaaggacagcagtatggactccccagcagggg
cgtttgggagagggttggctatacccatggtctctgaccctgcctgtctgacctctagga

Exon  7 +       4110       4176   0   Internal     67   100   Excellent
aggctcctgtctccaggagtcactggcgtagctctgagctccaagggagaaaggagggac
ccctgttccccaggctgagcccccactgaacaaggacagcagtatggactccccagcagg
ggcgtttgggagagggttggctatacccatggtctctgaccctgcctgtctgacctctag
GACCTGGCCCAGCTCTTTATCTGGGTCCTGCGGGAGTACAATGAAGTGGAGCCCATCATC
CTCTCCG
gtgggtacctcagccctcagcccccttcctccatggtaggacaggatccaaggttgtcct
gggaggctggctgaggggtgggagcaggaatattcatgggccgtcgggtggcaccaaggg
gaggcctgacccggtggctccccacagtgggcgaggaagatgaggtctccatcaaggagg

Exon  8 +       4324       4428   1   Internal    105    78        Good
agtacaatgaagtggagcccatcatcctctccggtgggtacctcagccctcagccccctt
cctccatggtaggacaggatccaaggttgtcctgggaggctggctgaggggtgggagcag
gaatattcatgggccgtcgggtggcaccaaggggaggcctgacccggtggctccccacag
TGGGCGAGGAAGATGAGGTCTCCATCAAGGAGGCAGCCGAGGCGGTGGTGGAGGCCATGG
ACTTCCATGGGGAAGTCACCGTATCCTCTGGCTCCAGTGCTGGGG
gttgggcgggggccccttgggcgggctcagtggccacccggtgtagggccagcgtgggtg
ggacactgcggagggaggatgctcaccctggcaggcggaggagctctgctgtggctcccc
tgggaatggcagaggttcaagggcaagctgcgggggctggggtggaggtgctcttctcgc

Exon  9 +       4962       5017   1   Terminal     56    84        Good
ctccctcatgctcgctaccagggcagaggtgaggtgccccctcagagcctgtactgccct
ggaggtgggacaccaaagctctgaggggtgacttccctgtccctgggcctcctcccccca
cttcctcccatgcggccccgaccctccctgtccatggccctcacctgcctgcctctgcag
CGGTGAAGGAGACCTGTGCTTGGTTCACTGACAACTACGAGCAGGCCCGGAAGTGA
agctggaagacaggatcaggtgccagcggaccatcggctggcagagcccagcggccacca
cccgtcaaccctgccaggagctgagggcaccacccagcaacctgggcctgcattccatcc
gctctgcagccccaagcatctttccagtggggcccccattcacgttggtcctcagggaaa

--------------------------------------------------------------------------------