--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (28830 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1175       1717   0   Internal    543    71        Good
cccggccagggacccgcccggacctgaggaggcgggaactgcgggcagaaggcccacccc
gctctcccaagatttcccgcgcacaccggaagtgggtggggctcctccgagcgccccctc
cctccccctcgccatcccccccgcacgattggccagcgccgctgtctctcagcgttccag
GGGAAGGGACTGGGCGATTCCCAGCACTCGGGTCGCGGGCGTTGGCAGCCGGGCGGGTGG
GAGGGGCCGGAGCAAAAGTTCCGGGCGCCCGAGCCGGCTGCTCGTGCCATGGAGCGGAGT
CCCGACGTGTCCCCCGGGCCTTCCCGCTCCTTCAAGGAGGAGTTGCTCTGCGCCGTCTGC
TACGACCCCTTCCGCGACGCAGTCACTCTGCGCTGCGGCCACAACTTCTGCCGCGGGTGC
GTGAGCCGCTGCTGGGAGGTGCAGGTGTCGCCCACCTGCCCAGTGTGCAAAGACCGCGCG
TCACCCGCCGACCTGCGCACCAACCACACCCTCAACAACCTGGTGGAGAAGCTGCTGCGC
GAGGAGGCCGAGGGCGCGCGCTGGACCAGCTACCGCTTCTCGCGTGTCTGCCGCCTGCAC
CGCGGACAGCTCAGCCTCTTCTGCCTCGAGGACAAGGAGCTGCTGTGCTGCTCCTGCCAG
GCCGACCCCCGACACCAGGGGCACCGCGTGCAGCCGGTGAAGGACACTGCCCACGACTTT
CGG
gtaagagcagcgatttgcacgaggcggccgagccgggtctggaacccggaatcccttggc
tctgcggctcccgcccctcctgcctgccagagcccagtgtgcccgcgtctcgctcccagc
atgcaggaccccacctctccgacccaggttctcagggctggctgcttcttcaaggtcggc

Exon  2 +       5835       5861   0   Terminal     27    50    Marginal
caaaatctctactcctggccaagatacttctgattctcccattactctgttccaagtgac
tacttaatccgcccaaatttctctgaagagctctggagctttcttgttacgggattggcc
ttcatttgggtccggcacattctttacctgctatgtgtatttctcttctttccttatcag
GACAAGACGATGAAAGTCATGTCTTGA
tatcaagtaagctgttaagaaaatatgaatggtggccgggtgtggtggctcatgcctgta
atcccagcactttgggaggccgaggcaggcagatcacgaggtcaggagttcgagaccagc
ctggccagtatggtgaaaccccatctctactaaaaatgcaaaaattaaccaggcatggtg

Exon  3 +       7921       7987   0    Initial     67    65    Marginal
tcagtccaggaggcaaggtatatagcagaaaaaacacaggcattccatgtactcattgac
tgggcaggtggttaactgaacatctactttgtgcagggacttggacatgcaggggacaaa
acaaagtctctcaccttgcagagcaagcattccttctgcagaagtgtaccgagcaccact
ATGCAAGGTAGAGAGGACCTGGAGGTTAAGACCTGCCCTCAGGAAAGAGAAGCTATTACC
CTGGATA
gtgagtgctgagacagaggtggccagggtgctgtgatgccctggaatggaacctgagctg
gcaagatcggggggcttcctggaggaaatgaggggtactagagccgagttttcaaggtga
tgttgggttagttgggggaagcaggtgggaaccaggcagagcaacagtgtgtatcaagtc

Exon  4 +      13918      14054   1   Internal    137   100   Excellent
ggatgtctgagggctctttatcccatggatgtctgattcaggatcaggaccttacttacc
atttgtgcccagagcacttggcatggatggggttaggcaaatgcagttgagttacacttg
tgttgaagtggagtcccagttgtaaatgtgatgtgtctgccctctctgcccagcctccag
CCCTAACCTGTCTTCCTCCCTCTCTCTCATTCCCATGTCAGGCCAAGTGCAGGAACATGG
AGCATGCACTGCGGGAGAAGGCCAAGGCCTTCTGGGCCATGCGGCGCTCCTATGAGGCCA
TCGCCAAGCACAATCAG
gtgagcgaacgatggggccaagtgggaagattgggtccactcagggcagtctggggagga
gtgaagatgtgtcagccgtggctttggctcacataacccgctgggtagaggtcggctgcc
ttacctctgatggtcctgtgcagccacgtcctggatgctgactgtggcttctctgccttg

Exon  5 +      18208      18452   0   Internal    245   100   Excellent
catttgaaatcggaacttagaaatttgtgcttataaactattatgttgatattttatctg
taggggttctatacatgatttatttgaacataaatttcctttgctaaaaatgggaaagtt
gctgggctatggatgtcctctccacatctgacccctgactcctcctgctgtcttccgtag
GTGGAGGCTGCATGGCTGGAAGGCCGGATCCGGCAGGAGTTTGATAAGCTTCGCGAGTTC
TTGAGAGTGGAGGAGCAGGCCATTCTGGATGCCATGGCCGAGGAGACAAGGCAGAAGCAA
CTTCTGGCCGACGAGAAGATGAAGCAGCTCACAGAGGAGACGGAGGTGCTGGCACATGAG
ATCGAGCGGCTGCAGATGGAGATGAAGGAGGACGACGTTTCTTTTCTCATGGTAAGGAGC
TCAGC
gtctggattcagtgacagggccacatgttccaggaccagctgggagccatagcccaccag
ccctggccaacgtcatcttcctggagcttcctgggtactggcctggaggagctcacaagt
aacctgctctgcttgtgtcatgaaactaaaaagacttatcagggcggagttccttgaaac

Exon  6 +      23238      23356   2   Internal    119   100   Excellent
ccctgttggccttggcccatctcccatcgtagcccagtccagtcttgtcttggagaaggt
ggccaggaaacttgggcctgagggaagggaacaagtcctgttgctggtttccagttggcc
cagttcggcccaggttgcatggctctggccctgcccaccatacccattgtacttttccag
ACTCTTCTGCACCATGGAGCCAGAGCCAGTCCAGCCCGGCATGCTTATCGATGTCTGCAA
GTACCTGGGCTCCCTGCAGTACCGCGTCTGGAAGAAGATGCTTGCATCTGTGGAATCTG
gtgagcgggggtgccggcaggtgtcccaagcatgggtggaagcccttcatgttagcaaag
aggcaccagggctggtctctgccgggcccacctcccacctcctcagagctcccctcctct
ctcagctgatccctctgccagtccctcgcaggcaggttcctgtaccctggtcttttccac

Exon  7 +      24391      24944   1   Internal    554    93   Excellent
tgccgcatatcttctgggggatacagcccaacccctgccaccactccagccctgggccac
tccttgcatggacttggggccaggtgtgacacagtggttggtttgtggggctggagatat
ccacgtgtggcctaagggacctcaggtttgctgattccccatttccgcctctgcttgcag
TACCCTTCAGCTTTGACCCCAACACCGCAGCTGGCTGGCTCTCCGTGTCTGACGACCTCA
CCAGCGTCACCAACCATGGCTACCGCGTGCAGGTGGAGAACCCGGAACGCTTCTCCTCGG
CGCCCTGCCTGCTGGGCTCCCGTGTCTTCTCACAGGGCTCGCACGCCTGGGAGGTGGCCC
TTGGGGGGCTGCAGAGCTGGAGGGTGGGCGTGGTACGTGTGCGCCAGGACTCGGGCGCTG
AGGGCCACTCACACAGCTGCTACCACGACACACGCTCGGGCTTCTGGTATGTCTGCCGCA
CGCAGGGCGTGGAGGGGGACCACTGCGTGACCTCGGACCCAGCCACGTCGCCCCTGGTCC
TGGCCATCCCACGCCGCCTGCGTGTGGAGCTGGAGTGTGAGGAGGGCGAGCTGTCTTTCT
ATGACGCGGAGCGCCACTGCCACCTGTACACCTTCCACGCCCGCTTTGGGGAGGTTCGCC
CCTACTTCTACCTGGGGGGTGCACGGGGCGCCGGGCCTCCAGAGCCTTTGCGCATCTGCC
CCTTGCACATCAGT
gtcaaggaagaactggatggctgagctggcccggggctgccccggtcttgtgccacagca
ctgttttctttctgccctcttcctaatgcccacactgcttgggcactattgcgcccctgc
ctccttgccaggctcttcctcctgtcctgcctggtccttttccatgactccaggctgtgc

--------------------------------------------------------------------------------