--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (27924 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (15 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1220       1341   0    Initial    122    75        Good
cggcaggacagtcagtggtcctgctgccgcagccccgtgcaggcttagaccgcccagcct
tgggatgagcgccgctgggggcggaggccgcgctcgggggcggggctggccgctgggggc
ggggcggggctggccgctggggcggggcccagcttgtcgctctttcccggaggctggcag
ATGCGCGTGGTGCGGCTGCTGCGGCTCCGGGCGGCTCTGACGCTGCTCGGGGAGGTCCCC
CGCCGCCCGGCCTCCCGGGGTGTCCCGGGCTCGCGCAGGACGCAGAAGGGCAGTGGAGCC
AG
gtaaggtgtcccagtgagcaggcggcgagggccctgagcaccgggcttgggtaggtccag
aaaggggagtggcaggcctcgtgggacggccttgccctgcttccggttttcccaaaagtc
gggccaggagagcatgcgtgccgcggtgtgaccggcccgcctcctgcccggggtgtacag

Exon  2 +       4742       4857   2   Internal    116   100   Excellent
catggggtctgaggtcaggtagggttgcctccctctgcaggccttgttttcctcccccgt
gaggtggaggccacactgctcacctgctaggagccacagggaggagccactgtgggagcg
gggaagaggctcatgcagggcctggcccaggagagtgacacgtcctgtctccgtctttag
GTGGGAGAAGGAGAAGCACGAAGACGGGGTGAAGTGGAGACAGCTGGAGCACAAGGGCCC
GTACTTCGCACCCCCATACGAGCCCCTTCCCGACGGAGTGCGTTTCTTCTATGAAG
gtaaggatgcagggagcggctcctccccagcctgcgcttggttccctgggcgtgggctcc
cagtgggcatctggctcgctccctcagcccccctgcaggcttctggctatgagcgctctg
tgccctcttcttgcaggtgatgcgtgggggctgctgaccaactgacccatgctcagaggg

Exon  3 +       6610       6731   1   Internal    122    86        Good
ccacgcaggttgattgtcgtgtgtcatgcagaacatgcttctgaacttacagaagaaggc
ctagcttcttgctcttggcatagtacgcacgaaagcgtagtttaaagcaatgaggtcatg
tcagctggaggccgagcctctggccgctctctcatacgatgtgtcttccgatgcctgcag
GAAGGCCTGTGAGATTGAGCGTGGCAGCGGAGGAGGTCGCCACTTTTTATGGGAGGATGT
TAGATCATGAATACACAACAAAGGAGGTTTTCCGGAAGAACTTCTTCAATGACTGGCGAA
AG
gtaggtaccctgggcggccgccacagctgtcctggacctggctggctaggcgtctgcggt
tctgcagtgctgcctctgaacgcccctcgcaagttctcggtggcccctgtgtgaccactc
acaggtgccgtcatggctctttgcagcttcgagctcctgggctcaagccatcctcctgtc

Exon  4 +       9737       9859   0   Internal    123    94   Excellent
ggggtctgcggggagaggctctatttacggggccgcaggaccgtgcgcaggttctgccta
ttgcacacacgcctccgtcggacatggcgagagcgcgtttctgtccgtcagacatggcga
gagcgctctgcatgtctgtccttcagacatggtgagagcgcgtgtctgtggtttttgcag
GAAATGGCGGTGGAAGAGAGGGAAGTCATCAAGAGCCTGGACAAGTGTGACTTCACGGAG
ATCCACAGATACTTTGTGGACAAGGCCGCAGCCCGGAAAGTCCTGAGCAGGGAGGAGAAG
CAG
gttgggctgcctcgagcgttgtgtgacctgaagtggcccctgggaacgagaggccggcct
ggcccaaagactgagaaaggcctgtggccttagagaagccccttctcacaaagctgctct
tttctcgtcagccttagcgcccctgcatgtgcttaagtgtcgttccgcttccccagagca

Exon  5 +      10548      10735   0   Internal    188    81        Good
ccccctgcaagcccacctgcactgtcccctgcccctgcaacctccatggattgtgaaggg
ctttgagggtccagctgagttagccagacagagcagggtggtcccgggttagcaacaacg
gactgaggcctgttctcttctcttcactgctaatgtccactgactgttttattaactcag
AAGCTAAAAGAAGAGGCAGAAAAACTTCAGCAAGAGTTCGGCTACTGTATTTTAGATGGT
CACCAAGAAAAAATAGGCAACTTCAAGATTGAGCCGCCTGGCTTGTTCCGTGGCCGTGGC
GACCATCCCAAGATGGGGATGCTGAAGAGAAGGATCACGCCAGAGGATGTGGTTATCAAC
TGCAGCAG
gtgcgtggccgggcgggcagcaggcgggcactggacccccgccacccgggtgaggctggc
ttttcttcacctcctgggagagggaggcacaccgagaaacatgtggttggtgacccccac
accattcctgtggagctcagcctgtaggcgtggccgggcaagggcggccttcccagggtg

Exon  6 +      11452      11596   2   Internal    145   100   Excellent
tagattgagtggctgcttttgtctgagctgccaggcaggccacctctgatgccagactcg
gtcaggagccatgccaccaccatagccaccacgtgggacggttgaccagagcagctcctt
ttgcttgcattccagagaataaggtctccaagttatgtttgggtcgttgttctgctgcag
GGACTCGAAGATCCCCGAGCCGCCGGCGGGGCACCAGTGGAAGGAGGTGCGCTCCGATAA
CACCGTCACGTGGCTGGCAGCTTGGACCGAGAGCGTTCAGAACTCCATCAAGTACATCAT
GCTGAACCCTTGCTCGAAGCTGAAG
gtgagcgcagggcttggcagggtgtttcctccccaggaggtccccctgaggacgccggca
gggaggtgtgtaagccgggcaccggcagaggcttctgagatgggctgggagtcggccagc
ccgtgctgaggtcatgctgtgccagcaggcacaagccccaaagccaggagtgggcatggg

Exon  7 +      11939      12082   0   Internal    144    99   Excellent
gccaggagtgggcatgggtgctcactgccggcatcacccagctagatttgctgccccagc
ccctgaccacggcaccactgagtggagaagcacgaggtttgggggagggagagttgacag
cctcctccgttatttaacaggaatgtgaatgttttctttcctgttattttcttcgtttag
GGGGAGACAGCTTGGCAGAAGTTTGAAACAGCTCGACGCCTGCGGGGATTTGTGGACGAG
ATCCGCTCCCAGTACCGGGCTGACTGGAAGTCTCGGGAAATGAAGACGAGACAGCGGGCG
GTGGCCCTGTATTTCATCGATAAG
gtatgcggccttctcgcttcctggcggctcttcatcctggttctcctggcgaggactccc
agttggatggtgcagtgtggcgacgtgggcctgtgtgtggggtggaacctcattctgatg
gggggggtgtgtgcatgtgcacacgtgtgtgggtgtgaacatgtgtgtagggtgtgcatg

Exon  8 +      14695      14880   0   Internal    186   100   Excellent
gtgtgtgtggcgtgcgtgtgtggcgtgcgtgtgtgtggcgtgcgtgtgtggagtgcgtgt
gtgtggcgtgcgtgtgtggcgtgcgtgtggcgtgcgtgtgtggcgtgcgtgtgtgtggcg
tgcgtgtgtgtggcgtgcgtgtgcacgcaccacccactttgaccattccccaccaactag
CTGGCACTGAGAGCAGGAAATGAGAAGGAGGACGGTGAGGCGGCCGACACCGTGGGCTGC
TGTTCCCTCCGCGTGGAGCACGTCCAGCTGCACCCGGAGGCCGATGGCTGCCAACACGTG
GTGGAATTTGACTTCCTGGGGAAGGACTGCATCCGCTACTACAACAGAGTGCCGGTGGAG
AAGCCG
gtgagtgccctcgcgccagctgcccccgctatgtgacacgtatttgctctggatgtctgg
gggcgtgccggagctgccgtggggtctgtggcccgtttgccacgtcctgcctgctgggtg
aggcctgctgtgccggggctgatcggggtaaaggtgaaggagaggctgtgcaccatggta

Exon  9 +      17995      18109   0   Internal    115   100   Excellent
gccacactggagggtgggggccgtgtcacgggaggatgccgacaggtgacggtgatgctg
ctcgggccaccttcctcagggaagcctcccgtgggctcccaggctctgcgtagacgccct
tcaggtcctcactggattcgggttttttctgtcctctgaaattccttctttctccttcag
GTGTACAAGAACTTACAGCTCTTTATGGAGAACAAGGACCCCCGGGACGACCTCTTCGAC
AGGCTGACCGTAAGCCGGCTCGTGTTTCCTCAGCAGTGGGCGGCGGCAGGACCCA
gtgagagggcgtgggcgctgagtctggcccagggttttgtcctgacccaacggctgacat
gtcctttccttcccgcgggaggctgggacggccccgcaaaaccacgtaattatagagacc
attttcctccccagacgaccagcctgaacaagcacctccaggagctgatggacgggctga

Exon 10 +      18244      18358   0   Internal    115   100   Excellent
gtaagccggctcgtgtttcctcagcagtgggcggcggcaggacccagtgagagggcgtgg
gcgctgagtctggcccagggttttgtcctgacccaacggctgacatgtcctttccttccc
gcgggaggctgggacggccccgcaaaaccacgtaattatagagaccattttcctccccag
ACGACCAGCCTGAACAAGCACCTCCAGGAGCTGATGGACGGGCTGACGGCCAAGGTGTTC
CGGACCTACAACGCCTCCATCACTCTGCAGGAGCAGCTGCGGGCCCTGACGCGCG
gtgagcctgccccacacccacactcagcgcggggggagcacggcccctgccccagaccgg
gctccccggctggcccttgttgagtgagcctcggggtggggccgcttctttgggaaatgg
gctgaggttgtgggctggctgcttggcagcctaggtggccagagtcctggggaggaggag

Exon 11 +      18973      19142   1   Internal    170    74        Good
gtcccctgccatcaacctggggatgctgtctaagcttggcgagggcctctcctccctctg
tccctggcgctgcccctgctccgtgatgtccgggctgctctgtgatgtccgggcagattg
gacgcacagactgtccagagggtgcctcccaccccggcgcccaccgcactccccaagcag
GGCTTCCTGGAGGAGGCGCCGAGGCTGGGTGCTCAGGGGCGCTGACGCTCGGCATGTGTT
TCGCGTGCACCCGTGGGCCTCAGAGGCCGGTGCTGTGCTGCCCTGGGGACAACCTTGGAG
CTGGGGCAGCACTGGGGCTGTGGGATGCGGAGGAGCTAGCTGGCATCCAG
gtgagagccccaggagaggagacgccccctccactgagggaggcagaagattctgggtga
gggcataggggccgaggccgggcctgggagaggaaatgaaggtgctgggcccactgtgga
cgtgcttccagagctgggtgggccatgcaggatgggcgtgaaggagtggccgctccagta

Exon 12 +      19955      20082   1   Internal    128    83        Good
gccctgctctcgaggccaccttggagggtcactgacccttggccctcactctccccatcc
cagtgggtgcctgtgtgagtggaaggggctgcgctgtgtggcgcgttaaggccggctcag
ggcagacagggagggtggccggccccgtgggtgctgcctctgacagcccgtgcctctcag
CCGAGGACAGCATAGCAGCTAAGATCTTATCCTACAACCGAGCCAACCGAGTCGTGGCCA
TTCTCTGCAACCATCAGCGAGCAACCCCCAGTACGTTCGAGAAGTCGATGCAGAATCTCC
AGACGAAG
gtagcagctcccaggagagcccccagcccagccctcaagggacccctccccctccccaga
gcctcggcacaggcctgggagccagctgcggtgggcacgtagggtgtggaagggtgtggg
cacaggggctggtgcgggatggggaggggcagccctgtctggacccttttcctgcagatc

Exon 13 +      20260      20354   0   Internal     95   100   Excellent
aaggtagcagctcccaggagagcccccagcccagccctcaagggacccctccccctcccc
agagcctcggcacaggcctgggagccagctgcggtgggcacgtagggtgtggaagggtgt
gggcacaggggctggtgcgggatggggaggggcagccctgtctggacccttttcctgcag
ATCCAGGCAAAGAAGGAGCAGGTGGCTGAGGCCAGGGCAGAGCTGAGGAGGGCGAGGGCT
GAGCACAAAGCCCAAGGGGATGGCAAGTCCAGGAG
gtgagtacccgtgccctcagacgccttctcccggggccctgtcccaacccgtagggtcca
gccccacagggtcggtgggagacgacccttgttgtctccttgtgcggagacgagagattg
tagaaataaagacacaagacaaagagataaaagaaaggacagctgggcccgggggaccac

Exon 14 +      25864      26034   2   Internal    171   100   Excellent
ggggtggggctgagcttccacctttgatcccggctggtcttttgctgtgatggatgactg
atgacaatgacagggacagggctgcactgggagggaaggcggcagggccagagaagtgca
ggtctcctcaggtggcgctagtccagcgcggggcctcgcggcctcctcttctcttgccag
TGTCCTGGAGAAGAAGAGGCGGCTCCTGGAGAAGCTGCAGGAGCAGCTGGCGCAGCTGAG
TGTGCAGGCCACGGACAAGGAGGAGAACAAGCAGGTGGCCCTGGGCACGTCCAAGCTCAA
CTACCTGGACCCCAGGATCAGCATTGCCTGGTGCGTGTGCCTGGGGTCTCA
gttcccacctgtggcctatggggggcctgggttttccaggaggcctctgttcagtcccag
cattgcccttgtcccgtgtcccctggggtcagcacaggccctccctgtgacagggaccca
tgatgctgagtcctgtgtcatcagctctccctgccctgaacgttcggatggacagggtga

Exon 15 +      26538      26640   2   Terminal    103    83        Good
gatgctccagggtggcggcatgcgtggggtggggttggcctagaggagcaggtcccagct
acaccaggcggctctggtgtctctgctgcatggaggacgctcgcccttgccgagcaccct
gacctggccttcaaggtgggtgagttgcctgcttgcctgggctgatgctgcctcccgcag
GTGCAAGCGGTTCAGGGTGCCAGTGGAGAAGATCTACAGCAAAACACAGCGGGAGAGGTT
CGCCTGGGCTCTCGCCATGGCAGGAGAAGACTTTGAATTCTAA
cgacgagccgtgttgaaacttcttttgtatgtgtgtgtgtttttttcactattaaagcag
tactggggaattttgtacaataaaatgtgtgcaagtgcttgtacatcactagaaaaagtc
cccaggccggccgggcacggtggctcacacctgtaatcccagcactttgggaggctgagg

--------------------------------------------------------------------------------