--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (29030 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (8 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        917       1112   2   Internal    196    59    Marginal
tcagtgcactggtcagtgaggccgctgtgggaggagggagtgggagcagaagctaagagt
ggactgaagtcctgaggccaggaagtagttcagggtttaagaagaggagagacaggcggc
ccggggagggagcaggctcaggatgggcctccagtgcctcctctggagctcactacccag
ACTACAGCAGCGCAGCGGGCAGCGCCTCAGCTCCTTCCCCTTCTGCTGCCTACAGCCTGG
ACAGGACCCGGAATCAAACCGCAGGCCCTGGGTCACCGCTGCCGGAAAGAGCCAGTTCCT
GTCCGTCCATGCACCCACCCACACAACCTGGGCCCTCCTGGAGGTGCTGGGGGAGACCCA
GCCTGAGTGCCTGGAA
gtgactgcgggaagggagtacaactgaccacgccttttttccggggtataaaagcggagg
agcacgttctattctggcagtgtagctgcgagaacctttgcacgcgcacaaactacgggg
acgatttctgattgatttttggcgctttcgatccaccctcctcccttctcatgggacttt

Exon  2 +       7058       7123   1   Internal     66    71        Good
tgttagcggtggacgagatccgagttaccctacgttgaaggcggcgaatccgtatgggtc
cacagcaccttcagctcttcgcctcctgagaagaaagaattggactgaggggcataaggc
agaaggagagacagaggcaagtttcagagcaggagtgaaagtttattaaaaaagctttag
AACAGGAAGGAAAGGAAGGAACGGAAAGAAAAGAAGGAAAGTACAACTTGAAAGATGGCC
GAGCAG
gtgacttgagaaacagtgcacagccggactgcctgagttggggttttataggttggccta
cttccaggatcttgccttacttctccccactcctgaaatcttattgggaagctgctgatc
agtttcaggtgttttctatgtattaggagactgcctttttctggcattggctgtaaccag

Exon  3 +      10239      10344   0   Internal    106    85        Good
aaaatagctacctaacaggccaggggacaaacacggatgcaaaagaatgaaagtttggaa
tgggaaaaaagtccaggctctcatgggttttgtcacttggggtgaagggaatgtgagacg
gagcctgggagaggtaaggtctggaagccactcaagcccatctctgccttgtccccacag
GTCCGGGTTGACTCTGCCACCATCCCCCGGCAGGACGAAGTTCCCCAGCAGACAGTGGCC
CCACAGCAACAGAGGCGCAGCCTCAAGGAGGAGGAGTGTCCAGCAG
gtgcactcttatttttaaaaatcagtttatttttagttgacagataaacattgtatatat
tcatggtgtacaccatgatgtttggaaatatgcacgcattgtgaaatggctaaatcaagc
taattcacatacttatcgtgtatttgttgtaagaacacttaaaagtctactcagcaattt

Exon  4 +      14982      15079   0    Initial     98    43    Marginal
tcagggaacgcccttcaccagtcagcctgttcacagattctgggcaggccatgtggtgtg
gttcaagggtggtcagagccagtatccagagaggtgacctgaggcctggctccatgaggg
ctgaactggcactggaataggccttgtacttgggtctgcagatgtcagccaggtgctgtg
ATGGGTCTCATCCTTGGGTCCACAGGGAAGGGCCTGGAGCCTGAGTTCATGGGGACTGAC
CTGGCACTAGGACAGATCTGGAAGCTGAATCTATGGAG
gtgggtcaggatcctgggtctgtagtgctagcccgaaggcacaagctaagactgatatct
tagcttatcatgcctttatcatgcccttatctctatgtgtttccagacttctgtttcctg
cactttctggttctttattccatagggacatgttggatgatttctgtcagtcaggcaccg

Exon  5 +      16667      16848   1   Internal    182    94   Excellent
agtgccagtcaaaggtatgtaatagtgtaatagatgcagaattgatgacaagaccaagcc
aagaagagcagatttctctgtctggattccactgagggccaaaagagaaatttgccagcc
attgtcagcctctgggaattctgtggtgactcattcattaacttttctctcccttcccag
GATCTCATAGATCAGAATATACTGGAGCCTGTAACCCGTGCACAGAGGGTGTGGATTACA
CCATTGCTTCCAACAATTTGCCTTCTTGCCTGCTATGTACAGTTTGTAAATCAGGTACAG
AATGTGTGGACCCCTTGCCCAGAGGTGGAGTGCATAGTGATGAGGTGGGAGCTGTAGCCG
AT
gtgagtcggggaaccaagttctagcccaacttggtagtcttcatcatgccctgttccatg
attatgactagttgattaaaaaaaaaaaatagaaatcttttttttcttttcttttattta
tttatttttttgaagacagtttcactcttgttgctgaggcttgagggcaatggcatgatc

Exon  6 +      19297      19550   2   Internal    254    63    Marginal
gcatgctcagacccttccccagcctcaagaagggagcacagggggacccactgctgacac
gaggagcctgtcctcctgacgccttctcagggactttgggcagggagggtggctcctctt
tcatcccacctggccagctttccatcaagagtccctgtctccctctctgtgtgtacccag
GTGTCCCAGAGGGATGGTCAAGGTCAGTAATTGTACGCCCCGGAGTGACATCAAGTGCAA
AAATGAATCAGCTGCCAGTTCCACTGGGAAAACCCCAGCAGCGGAGGAGACAGTGACCAC
CATCCTGGGGATGCTTGCCTCTCCCTATCACTACCTTATCATCATAGTGGTTTTAGTCAT
CATTTTAGCTGTGGTTGTGGTTGGCTTTTCATGTCGGAAGAAATTCATTTCTTACCTCAA
AGGCATCTGCTCAG
gtaggtgctggctgagggtgggagcgctgggcactgtctgccctgccctctcccactccg
ttcccacagacagtaatccccatccctgcccctggtccaagcgtctccagcctggcttgg
tcttccttcttgtgatcgccccatccccacgtcctgtgtatccccaaggaccctggtctc

Exon  7 +      27215      27335   1   Internal    121    92   Excellent
gtgttttgtgccttgagacgcagcaggaggacagggaatagggacggtgtcctaactgct
gtccctatagctgagagggctcttctggaggtttcactgctggaagcagggggccccatg
tcgatcctgtgctgatcgtccttggagcattgagaccctaaatctcttctctcttctcag
TCAGCACCTTGCTGGATGCCTCGGCAACACTGGAAGAAGGACATGCAAAGGAAACAATTC
AGGACCAACTGGTGGGCTCCGAAAAGCTCTTTTATGAAGAAGATGAGGCAGGCTCTGCTA
C
gtcctgcctgtgaaagaatctcttcaggaaaccagagcttccctcatttaccttttctcc
tacaaagggaagcagcctggaagaaacagtccagtacttgacccatgccccaacaaactc
tactatccaatatggggcagcttaccaatggtcctagaactttgttaacgcacttggagt

Exon  8 +      28442      28558   0   Terminal    117    48    Marginal
aaatcctccctctgtgggaggcacttactgcattccagttctccctcctgcgccctgaga
ctggaccagggtttgatggctggcagcttctcaaggggcagcttgtcttacttgttaatt
ttagaggtatatagccatatttatttataaataaatatttatttatttatttataagtag
ATGTTTACATATGCCCAGGATTTTGAAGAGCCTGGTATCTTTGGGAAGCCATGTGTCTGG
TTTGTCGTGCTGGGACAGTCATGGGACTGCATCTTCCGACTTGTCCACAGCAGATGA
ggacagtgagaattaagttagatccgagactgcgaagagcttctctttcaagcgccatta
cagttgaacgttagtgaatcttgagcctcatttgggctcagggcagagcaggtgtttatc
tgccccggcatctgccatggcatcaagagggaagagtggacggtgcttgggaatggtgtg

--------------------------------------------------------------------------------