--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (9692 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (7 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        315        407   0   Terminal     93    52    Marginal
gtggtttctataaatagatgagtaaataaattgacagttgaatataccaagcgtcctggg
gaccgcaggaggaactgtgtacagatggcttgaaggccagaggcttgggttgttgtcctg
gccctgccactggccagctgtttgaccttgaacaagtcagttccactctgtggacttcag
GGTCCTCACCCAGAAGAAGAGCAGCCATATGGTCTCTACTGCCTGGTAAACACCCTGGCT
CACTCTCGCGAGACGGTGGTTCTCAAAGTGTAG
tgtgtagtccacacaacacctgcattgcaaccactgggtatttatttatttatttattta
atttatttatttatgacggagtctcactctgtcgcccaggatggagtgcagtggcacgat
cttggcttactgcaacctctgcctcctgggttcaagtgattctcatgcctcagcctcccg

Exon  2 +       1137       1390   0    Initial    254    65    Marginal
ctaagctgcccctgcttctctcccctccatccctcgcctggccctgtcctccctactctc
ccctgcaccctcccccgccccaagctccccacaaacggccaaagcagcagtgtgaggcaa
tcgctctatccttgaccccttcctttgcacagtgagtgatggcgtttttatctcctgatg
ATGATGCACAGCCTTCAGCGGGGGACATTTAAGACGCAGAACACCAGGTCCAGGCTGCAG
CTGCGGGACTCAGAGGCGAAGCTTGAGGGGCTCAGGAAGGACGAAGAACCACCCTTGAGA
GAAGAGGCAGCAGCAGCGGCGGCAGCAGCAGCGGCAGCGACCCCACCACTGCCACATTTG
CCAGGAAACAATGCTGCTAGCGACATTCAAGCTGTGCGCTGGGAGCTCCTACAGACACAT
GCGCAACATGAAGG
gtgagcgctgcgggaaggaggcgatgaggggttggccagctctcagcggatgaggctcag
gccacccaattctgatcctagttgtgcctcttactgggtgaacctgggcaagtttcttcc
cttcttgaatctcagttttcccctcggaagaagtgggctggttactaagatatatccctt

Exon  3 +       3391       3504   1   Internal    114   100   Excellent
ctgccatgggagttgagggcctggctctagttcaggtccctgctagaatcctgtgtgctc
ctgagcaagtcacttccctctccaaaccaacttactcatttgagacaagatgagggggtg
ggagtggtccatctctaaggggctttccagctcctagacaagggttattcccttctgcag
GGCTGAGGCAACAGGCTGTGATGGCCATCAGCCAGGAGCTGAACCGGAGGGCCCTGGGGG
GCCCCACCCCTAGCACGTGGATTAACCAGGTTCGGCGGCGGAGCTCTCTACTCG
gtaagtgctgaggcttctgggctcctggtgctgctggcaggaggttccctggagggtgat
gtggtgcatgtggctttggctcccctcctgccattccttcattttgagaggacgtcccca
gcctagagttcctcaaggccagatccctctctggtcacctggggcggctgtgattaactc

Exon  4 +       3818       4009   1   Internal    192    74        Good
caaggccagatccctctctggtcacctggggcggctgtgattaactcgaccagcaggctg
gcccctatggctttagtccgggctcttcagagcaatgagcagacccagagctccagggat
gagagctggtggaggctgggagaagaaggaagctctgtctctcctcggctgtgtatccag
GTTCTCGGCTAGAAGAGACTCTCTACAGTGACCAGGAGCTGGCCTATCTCCAGCAGGGGG
AGGAGGCCATGCAGAAGGCCTTGGGCATCCTTAGCAACCAAGAGGGCTGGAAGAAGGAGA
GTCAGCAGGTAAGTGTCGGGGAGAAGCCTGTGGTTCCTCCATGCTCCACTGCCATCCTCA
AGGCCAGCTGGG
gttactatttttcccagaattcctgtctcatgcagcagtcactgggtagcaagtggtttt
atcttgagaactctcctttctcgagaatatatcctcagataatgctcttcccccataaaa
gacaccctggagagtcctgtttgagaaacactattcctgtgtccttagttacagaatagg

Exon  5 +       5735       5856   1   Internal    122   100   Excellent
ttggccaggctggtctcgaactcctgaccttgtgatccacccaccttggcctcccaaagt
gctgggattataggcgtgaaccaccatgcccggccaagaatatttttgtctaaccacctt
ctgggggctcctttctctgacaggacaatggggacaaagtgatgagtaaagtggtcccag
ATGTGGGCAAGGTGTTCCGGCTGGAGGTCGTGGTGGACCAGCCCATGGAGAGGCTCTATG
AAGAGCTCGTGGAGCGCATGGAAGCAATGGGGGAGTGGAACCCCAATGTCAAGGAGATCA
AG
gtgagcaaagtccaggtgcaggtggcaggggcccaggagagcccagtgtgaatgctgtat
caaagagaggacccctagctgtggggggtgcttagcccaacacaggctgagtcgtgattc
tggttccccatggcctggtaggtcctgcagaagatcggaaaagatacattcattactcac

Exon  6 +       5998       6174   0   Internal    177   100   Excellent
gcaatgggggagtggaaccccaatgtcaaggagatcaaggtgagcaaagtccaggtgcag
gtggcaggggcccaggagagcccagtgtgaatgctgtatcaaagagaggacccctagctg
tggggggtgcttagcccaacacaggctgagtcgtgattctggttccccatggcctggtag
GTCCTGCAGAAGATCGGAAAAGATACATTCATTACTCACGAGCTGGCTGCCGAGGCAGCA
GGAAACCTGGTGGGGCCCCGTGACTTTGTGAGCGTGCGCTGTGCCAAGCGCCGAGGCTCC
ACCTGTGTGCTGGCTGGCATGGCCACAGACTTCGGGAACATGCCTGAGCAGAAGGGT
gtcatcaggtaatacgggcagcaggctccaaacccccctcttctaacacaggcctgcagg
tgtgcacccaagcatgtggactgcatccccagctccaagaaaccaacccttggtgcaccc
atggcttccttctacaaaagaagatacttatttaccaaaggagggacaaagacaagatag

Exon  7 +       7759       7872   0   Terminal    114    72        Good
gaaagtcatgacagcagaggagcaatgcagtcctcccgcccttgactgggcaactccaag
gctgcacctattaacagagctcgaagaccaagcccctggcagcctgtttgtgatagggtg
cagtgtcaagagtgggccaaaacccacaagatggccaaattctcctacctcctactgcag
GGGTGGCTGCCCAAGAGCATCATCAACCAGGTCCTGTCCCAGACCCAGGTGGATTTTGCC
AACCACCTGCGCAAGCGCCTGGAGTCCCACCCTGCCTCTGAAGCCAGGTGTTGA
agaccagcctgctgttcccaactgtgcccagctgcactggtacacacgctcatcaggaga
atccctactggaagcctgcaagtctaagatctccatctggtgacagtgggatgggtgggg
ttcgtgtttagagtatgacactaggattcagattggtgaaagtttttagtaccaagaaaa

--------------------------------------------------------------------------------