--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (34839 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (20 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       2905       2990   1   Internal     86    76        Good
cccgactccccaagaccagcttggtttatttcacaatgactcgcgtcggattctcccagt
gtctgcggctccccctgcttcatcacaggcctgggacagtccaggcagccagggaatagc
tgggaatagcagttcccctttgttggtttttgagttcactgaggctttgatttcccccag
GGCCTGACGTTGCTGAGCAGAGCCAGCGGCCAGTAGATTTCAAAGGATTCCAAAAAACAG
TCAGGCACTCCTTTGTGAACCCAAAA
gtatctgagacaggtctgtcaatttagaaagtttattttgccaatgttaagaacacacat
gtgacacggcctctggagatcctgaggacatatgtccaaggtggccaaggtatggcttgg
tttcatacatttcagggagacatgagacattaatcaatgtatgtaagatgtgcaccggtt

Exon  2 +       8968       9037   2   Terminal     70    84        Good
tcaggcaacaataatgtcactttcacctaaggccagtaaaatgtgggtaaagtcatataa
tgatacaatgaaagtttctgatcagtatttcctaattcaagtgtgttgaaatgtggagtt
gggctggagaattgtcaaatcattgcgtatttaattaccttgtggtgatgtttgctttag
GGAGTGGAAGGAACATGAGGAACGAACGACCTTCATCACGGAAGATGACATTCATTTCGA
TTCACTTTAG
atttcagggcttgtttagatgcagactttgcagttaacattttattgcactgactgattt
agttttcaccaggtggtccttgtgtttgcttcagaaggatctaagtgtattaggacaggg
tttcttctgttttgattgtgggaggaggcgggatagacttctgttttcctagacccacaa

Exon  3 +      11242      11410   0   Internal    169    99   Excellent
ttttcagtcatttttaccttatgcgaacaagctgattagttcctttcctaggagctggtt
tttatggagggaagatggggccggtagaggcagatagagggggatgtaatacacaggcac
tgagacagcaccccactgactttcccctgtccctcctccagctggcctcctcctttccag
GGGCTGTGCCCAATCCAGAATCAGTTACTCACTGGTGCCCATCGACCATCATTTCCCCAT
GTGGCCACCAAAGAAATGAACACCACCTTTCTGGTTGGCATGATCATCAATTTCTCAGCC
AAAACGGCATGCATCCTTGGCTCTGGGAAACAGTACATCTCCCAGGAAA
gtgagcttacagcacggtaccccacttcctggttaccagactattgttcccgttttcccc
aagaacagtcatcattcacaggttgtttggcagggcccaggaacagagtcactctggttg
ctacagccaacagaccaaacacggcttccaggcaggaaggtcagagctgctctgcaggat

Exon  4 +      12378      12497   2   Internal    120    65    Marginal
ttggtgaggcccaaagtccatcccagccacgccctgcggtcccgagtctgagtccattgt
tctggctttcactctgctctgcatcccgtcactggccccagacctcgacgcccacctctt
cagcgaaggcgaaacaaggactcatttttcctccctctcttcgctctttcttgttttcag
ACTGCACTGTTTTTCTGCTGGCCGGATGACTCATTTCTTTGTCATCTCTTACCCCACTTG
GCCTTTTCAGCTGCTCGAATCGCCTCTGTGTGATGCGGACAGAGCTATCGCCCTGCTGGG

gtgagattcacttgcattgaatcagctcaaggcgcaggaaggtccagggaagccaaggaa
gagaagagacaagtctccaactctctcaggagcaaagacaaaaatatgctcctgctctct
tatctcttattcagaccgttcagttgcaaaagggttgaacatgatgcagcgggtggtatg

Exon  5 +      15384      15464   0    Initial     81    43    Marginal
gtgaaacaaaccagtcgcaaaagaagaaacactgtctcattccacttctaggatgtatgt
agagcagtcaggttcatacagacagaaagtagcagcgtggctgctggggaaaaggggaat
ggggagttattctttaatggctacagagtttcagttaggggtgatggagaagttctggag
ATGGGCGGTGGTGACGGCCGGCCGCACAGCAATATGACGTGCTTAATGCCACTGAACTGT
GCACTGAACATCGTTAAGGTG
gtaaattttgtgttatatatattttgcaacaataaaaaatatgtagtttctagaatcctc
ttctagatgcatgtctggcgtttctgccgcggggctggcactggaggaagccagacagga
caacattgcggcttatcctcctctgttgccatcatggacctctcgcaccccgtgatcaag

Exon  6 +      17463      17510   2   Internal     48    96   Excellent
ggagaggaagaattggactagaaggcaggagatggactttcacttgggccagttacccga
gggggtctctgagcagaggtatctggccggcaggttcacatgggcttctgggttggccgc
ctttactcttagtacacctggcatgtgctgatccttcctccacctctggtttcttcgcag
GAAATCCATGCCCGATTCAGAAGAGGAGCCAGATCTTACCAAGGTCGG
gtgaagctgaggggtgcatggggtcatcagggagggaggcagggcggggtgcagggtgca
tcacccacccaccacctgccttcttccacccaccacctgcctacggtgtgacagtgccat
tgcagcatgattctacagagatgcctgtgtcggcaccattctcccatcagctgcggccac

Exon  7 +      20861      20971   1   Internal    111    84        Good
atttttttcaaccaaaggcaggatgaaaacagtatttgtaggatgcagaactggtatacg
cgtgttccacgctgcaggacttgagtgtgtgtggattgtggtagacagggctcctggaac
catggcctgagcacacagaaggaggctgtcattaggggcttccttttttatacttgacag
GTTGCAGCGAGCCAAGGTGTTTCAACGGGGGCACCTGCCAGCAGGCCCTGTACTTCTCAG
ATTTCGTGTGCCAGTGCCCCGAAGGATTTGCTGGGAAGTGCTGTGAAATAG
gtgagtaggtgagagcacgtgaaacgagctgaaatcccacctctccagtctcccccgccc
ccggaaggaaaggcagggtgcgatggcagggccaggggtgggggccagggacagggaagg
cgcttctgccatgggtcaggaagcacagtgccacacagcaagcagagcctaggtgtgacc

Exon  8 +      21305      21479   1   Internal    175   100   Excellent
cacagcaagcagagcctaggtgtgaccctgaatccaggctggcacccttgccacccagcc
tgtggcttccgagccagcctgcatcaggcctgggggaggacggggcagagaggggagcct
cctgagggctgaatgaaaggggactcccatgtgaggcatccatgccctgctctctgtcag
ATACCAGGGCCACGTGCTACGAGGACCAGGGCATCAGCTACAGGGGCACGTGGAGCACAG
CGGAGAGTGGCGCCGAGTGCACCAACTGGAACAGCAGCGCGTTGGCCCAGAAGCCCTACA
GCGGGCGGAGGCCAGACGCCATCAGGCTGGGCCTGGGGAACCACAACTACTGCAG
gtgagggcacatccccaaggagggattccccctgtgagaagctgctacagctggggaaag
attctgtcagatccgtcagggttctcccaagaaacataaccaatacaggatggatagatg
gatagatgatagacagataatagatgataggtgatagatgatagattgatagatgataga

Exon  9 +      22294      22432   0    Initial    139    46    Marginal
gatagacagattgatagatgatagagagatagagatagagaaagaggagagagaaataga
gagagagagagaatgtgtgtgaacccaaagtatctgagacaggtctcaatcgatttagaa
agttgattttgccaaggttaaggacacccccgtgacacagcctcaggaggtcctgaggac
ATGTGCCCAAGGTTGTCAGGGCACAGCTTGCCTTTAGACGTTTTAGGGAGTCATGAGACA
TCAATCAACATGTGTGAGATGTACATCGGTTTGGTCGGGAAAGTTGGGATAACTCGAAGC
AAGGGCTTCCAGGCCATAG
gtagataagagacaaaaggctgtattctgagtccttgatcagcttttcactgaacacaca
attgagtctggctcagttcatctgcatttttacataaaaaatagggcagaggaagcaatc
agatacgcatttgtctcagatgagcagagggatgattttctgtcctgcacctgggaagat

Exon 10 +      22537      22662   2   Internal    126    83        Good
atcaacatgtgtgagatgtacatcggtttggtcgggaaagttgggataactcgaagcaag
ggcttccaggccataggtagataagagacaaaaggctgtattctgagtccttgatcagct
tttcactgaacacacaattgagtctggctcagttcatctgcatttttacataaaaaatag
GGCAGAGGAAGCAATCAGATACGCATTTGTCTCAGATGAGCAGAGGGATGATTTTCTGTC
CTGCACCTGGGAAGATAAGCTATCCATTTACAATGCCAAGGTGAAAGTCAACAGAACTGT
TTTAGG
gtaaagatctttaggcctgcaaggaatgtccttgtagagaattaaaaaaaaaaaaaaaaa
actttgcagctatcttattgaggaataaatgagaggcaggtttgcctgacgtagttcccg
gcttgacatttcccttggctcatgacgttggggtcctgagatttattttcctttcacact

Exon 11 +      22849      22913   0   Internal     65    57    Marginal
atctttaggcctgcaaggaatgtccttgtagagaattaaaaaaaaaaaaaaaaaactttg
cagctatcttattgaggaataaatgagaggcaggtttgcctgacgtagttcccggcttga
catttcccttggctcatgacgttggggtcctgagatttattttcctttcacactagatag
ATAGACATTTATGTTAAGGAACTGGCTGACAGGATCGTGGGGGCTGGCAAGTCCGAAACA
TCTTG
gtaagccaggctggaagtgcaggcagaagctgaggctgctctcttaaggcagaatttctt
attcaggaaacctcatatttgctcttaaggcctttaagtgattggacgaggcccaactac
attatctaggacaatttccttttctaaagtcaactggctgtagatattaaccacatctat

Exon 12 +      23705      23796   2   Internal     92    95   Excellent
aacggaggttgcagtgagaggagatgcgccgctgcactccagcctgggataaacagcgag
actctgtcaaaaaaaaaagcaccccccattcctccagaaaaggataccaaagtccttggg
tcctaaaggagaggcttcacctttgacctaccctggcccttcccttggctgatttttcag
AAACCCAGATCGAGACTCAAAGCCCTGGTGCTACGTCTTTAAGGCGGGGAAGTACAGCTC
AGAGTTCTGCAGCACCCCTGCCTGCTCTGAGG
gtaagtggcagccaccccgcctttccctgaatgtccctgggggaggaaagtccaggagga
caggccgatagccctcctgcacctgaggggagaaagggggaggccaggagtgagtcattt
tggttgcagagggaagaaagacaggacttaggtctgtgcctgggcttggcctctgactgg

Exon 13 +      25987      26158   1   Internal    172   100   Excellent
gatcgcgcattgcactccagcctgggcaacaaaaggggaagtgtgaggtgttacactctt
ctcagtgccgggctagcggcctccagcttcctcgaccggcagctccgcttcaagccccag
ccctgacttgcgtgcttcagaatttgtttttgtttcagtttgagaattcttttcttctag
GAAACAGTGACTGCTACTTTGGGAATGGGTCAGCCTACCGTGGCACGCACAGCCTCACCG
AGTCGGGTGCCTCCTGCCTCCCGTGGAATTCCATGATCCTGATAGGCAAGGTTTACACAG
CACAGAACCCCAGTGCCCAGGCACTGGGCCTGGGCAAACATAATTACTGCCG
gtaggtagcacaggggtggggggttcaggtcttggcagaacgtgggattagggtgtgaga
cgggggaagatccaatgtctcaagttgcatgacagacccagtgcgtgggaagcacccatg
gatattatctaatccaacctcttcacttgctagaataacacatattgtgaaaagcaaggt

Exon 14 +      26855      26940   2   Internal     86    98   Excellent
actcctggcctggtgtggtggtgcatgcctgtaatcccagcactttgggaggctgaggca
ggaggattgcttgagcccaggagttcaagaccagcctgggcaacatggcaagaccccatc
tctacaaaaattaaaaaataagaagataaaaaggaaaccttaaactctcttatcatttag
GAATCCTGATGGGGATGCCAAGCCCTGGTGCCACGTGCTGAAGAACCGCAGGCTGACGTG
GGAGTACTGTGATGTGCCCTCCTGCT
gtaagggctgggccccggctgcctccctgcacctggtctcccttcttcaccatctcctcg
ccactttctaggccttcatggctgtctggtgcagactgtgtgcctaccagacttccaggc
tgggtggggagggggcttccatgactgaagccacggtgggtgggcgggtgtccatgaccc

Exon 15 +      28192      28387   1   Internal    196    84        Good
ctccgcctcctgaaacttatcgctgtgggaactaaagagaatgtatggacaacattcggc
atgctgatcccaccaagtgaaagttgtggttttacagccatgctgatggcctcctcactc
tacctacacacgtgcaggaggcctgtgggactgactgcctcctcgtcctttcctccccag
CCACCTGCGGCCTGAGACAGTACAGCCAGCCTCAGTTTCGCATCAAAGGAGGGCTCTTCG
CCGACATCGCCTCCCACCCCTGGCAGGCTGCCATCTTTGCCAAGCACAGGAGGTCGCCCG
GAGAGCGGTTCCTGTGCGGGGGCATACTCATCAGCTCCTGCTGGATTCTCTCTGCCGCCC
ACTGCTTCCAGGAGAG
gtaggggctcggaaacccagttggtttttccaccctctaacgcctagaaaccaagccctt
taggggaaatcccacagcaaaaaaagcattctaaggctgtttctccaccaggtttccgcc
ccaccacctgacggtgatcttgggcagaacataccgggtggtccctggcgaggaggagca

Exon 16 +      28499      28635   2   Internal    137   100   Excellent
gttcctgtgcgggggcatactcatcagctcctgctggattctctctgccgcccactgctt
ccaggagaggtaggggctcggaaacccagttggtttttccaccctctaacgcctagaaac
caagccctttaggggaaatcccacagcaaaaaaagcattctaaggctgtttctccaccag
GTTTCCGCCCCACCACCTGACGGTGATCTTGGGCAGAACATACCGGGTGGTCCCTGGCGA
GGAGGAGCAGAAATTTGAAGTCGAAAAATACATTGTCCATAAGGAATTCGATGATGACAC
TTACGACAATGACATTG
gtaagagctcgtcattcccggctccagttcatacagatcacacaacacacccacatgcac
tcacctatgtttacacacacgggcctcctcctccagcccctgcccctcctgcgtgttcct
cccctcccggggacgcggccctcacgccagctcactcctcctttctccctcccagcgctg

Exon 17 +      28811      28955   1   Internal    145   100   Excellent
cattggtaagagctcgtcattcccggctccagttcatacagatcacacaacacacccaca
tgcactcacctatgtttacacacacgggcctcctcctccagcccctgcccctcctgcgtg
ttcctcccctcccggggacgcggccctcacgccagctcactcctcctttctccctcccag
CGCTGCTGCAGCTGAAATCGGATTCGTCCCGCTGTGCCCAGGAGAGCAGCGTGGTCCGCA
CTGTGTGCCTTCCCCCGGCGGACCTGCAGCTGCCGGACTGGACGGAGTGTGAGCTCTCCG
GCTACGGCAAGCATGAGGCCTGTAA
gtggaaggaagtctcggccccatcctgtctgcgggacagcaggggaggctgcggtccacc
agaggaaaatggggtcaggagaccgaagttccagccccgggtcaggcactgacgccagtc
ccgtctccctgtgtcgtgggggcccgtctctgctgtctctgcctcacagggacactgcag

Exon 18 +      29902      29980   2   Internal     79    77        Good
atgttagctattattggaaaatttggctttctctttcaaaaacgtttataaataactttc
cctaaaaccatatgatggttctcccctttcagtgtctcctttctattcggagcggctgaa
ggaggctcatgtcagactgtacccatccagccgctgcacatcacaacatttacttaacag
AACAGTCACCGACAACATGCTGTGTGCTGGAGACACTCGGAGCGGCGGGCCCCAGGCAAA
CTTGCACGACGCCTGCCAG
gtaaccaggagtggcgcgcccatgctgggcacaacccaggggagaatgcccctgggacaa
caggttcttcaccaaagaaaaaagttatcaccagagtggagtgatttcctcttagtgata
cccctggggattctagatgagggcctcacagaataaagcaactggaggaagatcaaagtc

Exon 19 +      32726      32884   0   Terminal    159    96   Excellent
tccccagacaggaattgatttttgttttcctcatcaaagttataatgaaatgacactgaa
tggaatattattgaagggcctgctgtattttgaagattacgatgttcatgctacacatac
tgactttctccagatagtctgctttttttgcaaacgccaaacctgctatctcctttgcag
GGCGATTCGGGAGGCCCCCTGGTGTGTCTGAACGATGGCCGCATGACTTTGGTGGGCATC
ATCAGCTGGGGCCTGGGCTGTGGACAGAAGGATGTCCCGGGTGTGTACACCAAGGTTACC
AACTACCTAGACTGGATTCGTGACAACATGCGACCGTGA
ccaggaacacccgactcctcaaaagcaaatgagatcccgcctcttcttcttcagaagaca
ctgcaaaggcgcagtgcttctctacagacttctccagacccaccacaccgcagaagcggg
acgagaccctacaggagagggaagagtgcattttcccagatacttcccattttggaagtt

Exon 20 +      34113      34196   0    Initial     84    41    Marginal
aaatagaatcttaaggaaaaaataactgggtgagacgtggactgtggacaggtgtggaaa
aggcactctccatggaggtatgaatatgtagagggccaagagaggggagtacagggagaa
atgagttgagcttgtctgaagtgaacttcaggaagaggaacataggctggaatttagatt
ATGGGGGCTCTGAACACCAAACTGAGTTTGGACTTAATTGACTTCTGTAGGCAACGAGGA
GCCATGGAGATTCTGCTCAGGGAA
gtgaggaactgggcatgccttaggaaaattaaccagggggtggctggcaagcaagcagac
agcaggaaaggaacgctgtggggatagggaggaagaacctcgcatgaccttgctaacaca
gcaacatcccaaccgttggttcggcctagaagctggtatttgggccatctgtttcccatt

--------------------------------------------------------------------------------