--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (15010 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (27 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1179       1374   2   Internal    196    84        Good
catttggccctcagggggctggaggtcagaggtcaggccacctctgccacggggtggttg
gaacagctgggtcctgaccctgaaggcccggaatgcggctgaggcgagggggcaggggca
gctgctgacctcacaatagcagggtctgctgtccctggccggcctgctggcccccgccag
CTGCCGCCGCTGGCTGCCAGGCATGTCCCTCCTCAGCAGCTATGAGGGCCTGCGGCAGGA
GATCCAGCGGCTGGCACAGGAGAACGAAGAGCTGCGGCGGCTGGTGCAGCTCATCCAGGA
GAACCAGGAGCTGAAGCTGGTGCTCAGGAACCGCGGCAGCAGCCTGGGCTTCTGCAGCTC
CGGGTTCCTGGCTGAG
gtggctgccagtccctggctacccaggcggagaacgatcaaattcaagaatgctgagaga
ggtgagccgtaccggggccccaagactctgtggagttgggcaaacccgctgggtgctgcg
gtgcctctggagcaaagccagggccctggggctcttccaggatgtgcggcggggagaagg

Exon  2 +       1845       1929   0   Internal     85    57    Marginal
tgggtgcaagttgtctgtgcctgaagctgtcagagtcactgcaacggcagactctgtcct
cccagccctgcgctctctggtggtggggacagccatatccctgggggaacgtgatggaag
cctggccggggtggaggtgtgagaagtagcagctctgtgttctgaaggtgaaagtaacag
GACTTCTGGCAGATTGCGTGTGGGGATGAGAATGGGGCTGGGGCAGCTCGCTGGGTGGGG
GAGCCGCTGCTGGAGTGGGCCACTG
gtaggtggcctggggcttggttttgggacgtgtctggccatgcagtcagaggcgccacta
gagagtaggggccgggccatcccgcaggcctggagctgcctctggttgctgtggaggggc
tgcgtggcattgccaaggggaagctgggacccagcaacatggagggacagagataaaggc

Exon  3 +       5059       5273   1   Internal    215    90   Excellent
ggccaggctctcgctcgggcccaggctgccctcggagctgggcctgcggctctggctctt
cccagagtcgtgcccgtgggtctctccctcaggaaccccccgcatgcgcagggctgggga
gcctctagtcccactcgcaggtgagcccgggctgaccccgcctccgtccagtttttccag
GGCTACCAGCTGAAGAGCTCCTGTGGGACTCCAGCCCCACCACCATGGGCAGCCCCGAGG
GCCGCTTCCACTTTGCCATCGACCGTGGGGGTACCTTCACAGACGTCTTTGCCCAGTGCC
CAGGGGGGCACGTGCGGGTCTTAAAACTGCTCTCAGAGGACCCTGCCAACTATGCGGACG
CGCCAACCGAAGGCATCCGCCGCATCCTGGAGCAG
gtgggccagggcggagcgggtggacagggaccccacggccagaagccccacactgaccac
gtggtccccaggaggccggcatgctcctgccccgggaccagccgctggactccagtcata
tcgccagcatccgcatgggcaccacagtggccaccaacgcactgctggagcggaaggggg

Exon  4 +       5345       5536   0   Internal    192   100   Excellent
ctttgcccagtgcccaggggggcacgtgcgggtcttaaaactgctctcagaggaccctgc
caactatgcggacgcgccaaccgaaggcatccgccgcatcctggagcaggtgggccaggg
cggagcgggtggacagggaccccacggccagaagccccacactgaccacgtggtccccag
GAGGCCGGCATGCTCCTGCCCCGGGACCAGCCGCTGGACTCCAGTCATATCGCCAGCATC
CGCATGGGCACCACAGTGGCCACCAACGCACTGCTGGAGCGGAAGGGGGAGCGGGTGGCG
CTGCTGGTGACACGTGGCTTCCGAGACCTGCTGCACATTGGCACCCAAGCCCGTGGGGAC
CTCTTTGACCTG
gtgagctccatgttggctggggaccaggctgtgtggtgtacaccccccagggatgccttg
accctgtggggagagcagttgttggattagtgatggctcatgggcaccagccgacaaaga
ggaagctcccgaattcccagtgggaccccaagttctcctagccctcggagtgggcacagg

Exon  5 +       5740       5758   0    Initial     19    42    Marginal
ccaggctgtgtggtgtacaccccccagggatgccttgaccctgtggggagagcagttgtt
ggattagtgatggctcatgggcaccagccgacaaagaggaagctcccgaattcccagtgg
gaccccaagttctcctagccctcggagtgggcacaggatgccctgttcctgcctgccgcc
ATGCCCACCCTGGATGCTG
gtgtggggccacccaagctaccctgttcaggcagaggaggggtggaaccccgcacctact
gctgcgtttccggaagaagctgccttcgtgggggtggagcagttggctgcactcagctgc
ctagggggtggagagctgcccccttggtgagccttgctggggctgccaggtatgactctc

Exon  6 +       6056       6195   0   Internal    140   100   Excellent
tgcctagggggtggagagctgcccccttggtgagccttgctggggctgccaggtatgact
ctcctgggcctgccgaccggcctgttgggacacagccactcacctgtaccacccactcac
acaggaccccggcctggaccctcaggcctgggcctcttctgagtctctgcccgcccccag
GCCGTGCCCATGCCTGAGGTGCTGTATGAAGAGGTGCTGGAGGTGGACGAACGCGTGGTG
CTGCACCGTGGAGAGGCGGGCACCGGGACGCCTGTGAAAGGTGTGTGTGCCGCCGCTGCT
GTGGGATTTGGGGCCGGAGG
gtcctgctggcctttaacggggcctcctgggcttttctggaaggccgcacgggggacctg
ctggaagtgcagcagcctgtggacctgggggccctgcgtgggaagctggaggggctgcta
tctcgaggcatccgcagcctggctgtggtgctcatgcactcgtacacgtgagtgaggtgg

Exon  7 +       6444       6639   2   Internal    196    80        Good
gcagcagcctgtggacctgggggccctgcgtgggaagctggaggggctgctatctcgagg
catccgcagcctggctgtggtgctcatgcactcgtacacgtgagtgaggtggggctgtgg
gctgcgggagcaggtgccgggcctggtgggagacgaggtgccactgggtttttgtcatag
GTGGGCCCAGCATGAGCAGCAGGTGGGTGTGCTGGCCCGGGAGCTGGGCTTCACGCACGT
GTCACTGTCCTCGGAGGCCATGCCCATGGTGCGCATCGTCCCTCGGGGGCACACGGCCTG
TGCCGACGCCTACCTCACGCCCGCCATCCAGCGCTACGTGCAGGGCTTCTGCCGTGGCTT
CCAGGGCCAACTCAAG
gtgaggctgtgaggcacccccactgcccactcctgggcctgggcctgggccttggcctgc
ccctcatggcccgcctgctgcccgctcgcaggatgtgcaggtgttgttcatgcgctccga
tggcggcctggcgcccatggacaccttcagcggctccagtgctgtgctctcgggcccggc

Exon  8 +       6731       6896   0   Internal    166    94   Excellent
ggcacacggcctgtgccgacgcctacctcacgcccgccatccagcgctacgtgcagggct
tctgccgtggcttccagggccaactcaaggtgaggctgtgaggcacccccactgcccact
cctgggcctgggcctgggccttggcctgcccctcatggcccgcctgctgcccgctcgcag
GATGTGCAGGTGTTGTTCATGCGCTCCGATGGCGGCCTGGCGCCCATGGACACCTTCAGC
GGCTCCAGTGCTGTGCTCTCGGGCCCGGCCGGCGGCGTGGTGGGCTACTCAGCCACCACC
TACCAGCAGGAGGGTGGCCAGCCTGTCATCGGCTTTGACATGGGAG
gtatgagggccgagggctggggtctcggggaggctcagctgctgggcccctgggtcttca
agtgacccaccagcaccccacccctgccaggcacgtccacggatgtgagccgctatgctg
gggaattcgagcacgtcttcgaggccagcacagctggcgtcaccctccaggccccgcagc

Exon  9 +       6987       7090   1   Internal    104    95   Excellent
tctcgggcccggccggcggcgtggtgggctactcagccaccacctaccagcaggagggtg
gccagcctgtcatcggctttgacatgggaggtatgagggccgagggctggggtctcgggg
aggctcagctgctgggcccctgggtcttcaagtgacccaccagcaccccacccctgccag
GCACGTCCACGGATGTGAGCCGCTATGCTGGGGAATTCGAGCACGTCTTCGAGGCCAGCA
CAGCTGGCGTCACCCTCCAGGCCCCGCAGCTGGACATCAACACC
gtggcagcgggagggggttcccgcctcttcttcaggtcagctctcctgcttcccaggctg
ggaccccagccctgtctccctcctcgtgtccaactccaaccccagcccttccttccccta
ggtctggcctctttgtggttgggcccgagtcagcaggagcccacccaggacccgcctgct

Exon 10 +       7422       7687   1   Internal    266    85        Good
agcaggagcccacccaggacccgcctgctaccgcaaaggtaagagtcaggatctggccgg
cctggccttgccctccgcttgccgccgcaggcccagcccctcctgtcagccctatccctg
ctgcctactcctgctcccctgcctccagcccccaagccccacaccctgtccacctcccag
GGGGCCCTGTGACAGTGACGGATGCTAATCTGGTCCTGGGTCGCCTGCTGCCTGCCTCCT
TCCCCTGCATTTTTGGGCCGGGAGAGAACCAACCACTTTCCCCTGAGGCCTCCCGCAAAG
CCCTGGAGGCTGTGGCCACTGAGGTCAACAGCTTCCTGACCAACGGGCCCTGCCCGGCCT
CCCCGCTGAGCCTGGAGGAGGTGGCCATGGGGTTCGTGCGCGTGGCCAACGAGGCCATGT
GCCGGCCCATCCGTGCACTCACGCAG
gtacgtccacctctgctctcccgcctgtcctgcccccagccctgctccctgccccaggcc
tcctgctcaggctgggggctggatggggtagagtaggagagcccactgaccccttctgtc
tccctaggcaagaggccatgacccctcagcccatgtgctggcctgctttgggggagctgg

Exon 11 +       7815       7927   0   Internal    113   100   Excellent
tcgtgcgcgtggccaacgaggccatgtgccggcccatccgtgcactcacgcaggtacgtc
cacctctgctctcccgcctgtcctgcccccagccctgctccctgccccaggcctcctgct
caggctgggggctggatggggtagagtaggagagcccactgaccccttctgtctccctag
GCAAGAGGCCATGACCCCTCAGCCCATGTGCTGGCCTGCTTTGGGGGAGCTGGTGGGCAG
CATGCATGTGCCATCGCCCGGGCCCTGGGCATGGACACGGTGCACATCCACAG
gtgggcctgggtgtgggtgcacggaggtggtgtgatctgcgccgggcttgggaggtgacc
tcccattgccatgctgcccatccctgcaggcacagtgggctgctgtcggccctggggctg
gccctggctgacgtggtgcatgaggcacaggaaccctgctccctgctctacgcgcctgag

Exon 12 +       8017       8187   2   Internal    171   100   Excellent
cccatgtgctggcctgctttgggggagctggtgggcagcatgcatgtgccatcgcccggg
ccctgggcatggacacggtgcacatccacaggtgggcctgggtgtgggtgcacggaggtg
gtgtgatctgcgccgggcttgggaggtgacctcccattgccatgctgcccatccctgcag
GCACAGTGGGCTGCTGTCGGCCCTGGGGCTGGCCCTGGCTGACGTGGTGCATGAGGCACA
GGAACCCTGCTCCCTGCTCTACGCGCCTGAGACCTTCGTGCAGCTGGACCAGAGGCTGAG
CCGCCTGGAGGAGCAGTGTGTGGATGCTCTGCAGGCCCAGGGCTTCCCCAG
gtgggctcccagggtgccctggacagagggcttacgttgtcctcaccacgcccttggtgg
gtgttcctcctgatgacttcccaggtggtcccggggtgtgcgagaagcagaacaggtgtc
cttgccgggcgctgggtggggtggggtcagggcagggggtttggtgtgagtgcccccaac

Exon 13 +       8380       8517   2   Internal    138    96   Excellent
ggtgccctggacagagggcttacgttgtcctcaccacgcccttggtgggtgttcctcctg
atgacttcccaggtggtcccggggtgtgcgagaagcagaacaggtgtccttgccgggcgc
tgggtggggtggggtcagggcagggggtttggtgtgagtgcccccaaccacctgctgcag
GTCCCAGATCAGCACTGAGAGCTTCCTGCACCTGCGCTACCAGGGCACGGACTGTGCTCT
GATGGTGTCTGCCCACCAGCACCCAGCCACAGCCCGCTCGCCCCGTGCGGGGGACTTCGG
GGCAGCCTTTGTGGAGCG
gtacgtggcttcctgactccggatccctggcaaggggccctcctgtctggccgcctcact
ctgaccactccttgggtccccgcggggagtgcaggtacatgagggagtttggctttgtca
tacctgagcggccggtggtcgtggacgatgtgcgagtgcggggcaccggccgcagtggtc

Exon 14 +       8612       8815   2   Internal    204    73        Good
tgtgctctgatggtgtctgcccaccagcacccagccacagcccgctcgccccgtgcgggg
gacttcggggcagcctttgtggagcggtacgtggcttcctgactccggatccctggcaag
gggccctcctgtctggccgcctcactctgaccactccttgggtccccgcggggagtgcag
GTACATGAGGGAGTTTGGCTTTGTCATACCTGAGCGGCCGGTGGTCGTGGACGATGTGCG
AGTGCGGGGCACCGGCCGCAGTGGTCTTCGCCTCGAGGATGCCCCCAAAGCCCAGACCGG
GCCTCCCCGGGTGGACAAGGTTGGTGGTCCTGCCTGTGCCAGCCTGACAGCACCCATGGG
GCACCGGGATGGGGACCAAGCCCT
gtgagaggcatcggggagggtgctgggcccgggcgctgtactcacccgcaccctctgcag
atgacccagtgctactttgaggggggctaccaggagacccctgtgtacctgctggcagag
ctgggctatgggcacaagctccatgggccctgcctcatcatcgacagtaacaggtgggct

Exon 15 +       8876       8988   0   Internal    113    83        Good
tcttcgcctcgaggatgcccccaaagcccagaccgggcctccccgggtggacaaggttgg
tggtcctgcctgtgccagcctgacagcacccatggggcaccgggatggggaccaagccct
gtgagaggcatcggggagggtgctgggcccgggcgctgtactcacccgcaccctctgcag
ATGACCCAGTGCTACTTTGAGGGGGGCTACCAGGAGACCCCTGTGTACCTGCTGGCAGAG
CTGGGCTATGGGCACAAGCTCCATGGGCCCTGCCTCATCATCGACAGTAACAG
gtgggctgaagtccggccagggtggaggatgtggacgggtccactgcggggcccctggtg
cagggttctctggcccaaggctgcaggggcctgcaggactctgtatcccaccatcgttgg
ggtggcccctggcctggggccgtggcatctctggttggaggggtgtcgcctggccccatg

Exon 16 +       9196       9347   2   Internal    152   100   Excellent
gatgtggacgggtccactgcggggcccctggtgcagggttctctggcccaaggctgcagg
ggcctgcaggactctgtatcccaccatcgttggggtggcccctggcctggggccgtggca
tctctggttggaggggtgtcgcctggccccatgcagccctctgtgccctctgctccccag
CACCATCCTGGTGGAGCCAGGTTGCCAGGCAGAGGTGACCAAGACAGGGGACATCTGCAT
CTCCGTGGGGGCCGAAGTCCCCGGCACAGTGGGCCCCCAGCTGGACCCTATCCAGCTGTC
CATCTTCTCACACCGCTTCATGAGCATTGCTG
gtgagtggccgctgccaggctccctgtgggatgaggcgccggctgtgtcatggggtagct
ggcagggctgtgcccaaagggagaggcagaagcaggaccccctggcgacggggcgggcag
tgtggccgcagcactggtgtggtgcagttggccatgagaacaaaccttgggcagggagga

Exon 17 +       9946      10106   1   Internal    161   100   Excellent
ctttacataggctaagacgtggccaagtgggcacaccgtcaacttggtcttccccaggaa
aaagctgctgggtttttcctgggtcctgggtttgagtcctggtgggtcctgttcctccct
ttcctggggccaggctgtgggtgggtggggccagcgggcctggtcactttgtgctcctag
AGCAGATGGGCCGCATCCTGCAGCGCACAGCCATCTCCACCAACATCAAGGAGCGTCTGG
ACTTCTCCTGTGCCCTCTTTGGGCCCGATGGGGGGCTGGTGTCCAATGCCCCCCACATCC
CTGTGCACCTGGGTGCCATGCAGGAGACGGTGCAGTTCCAG
gtggcccttcccccgcctcacccttccatccccctccctcaccctccaccccccccccac
cccgctctggcccctgctcccctgtgcccactctgcacccatctcctggtttcagattca
gcacctgggggccgatctccaccctggcgacgtgctactgagcaaccatcccagtgccgg

Exon 18 +      10222      10323   0   Internal    102    75        Good
tggtgtccaatgccccccacatccctgtgcacctgggtgccatgcaggagacggtgcagt
tccaggtggcccttcccccgcctcacccttccatccccctccctcaccctccaccccccc
cccaccccgctctggcccctgctcccctgtgcccactctgcacccatctcctggtttcag
ATTCAGCACCTGGGGGCCGATCTCCACCCTGGCGACGTGCTACTGAGCAACCATCCCAGT
GCCGGGGGCAGCCACCTGCCAGACCTGACTGTTATCACACCG
gtgaggggtgctgcccgcctgcctctgctggggcagtggtggccgatgcagctgaccgtg
gctctccacccgctaggtgttttggccgggtcagacgcggcctgtgttctatgtggccag
ccgagggcaccacgcagacatcgggggcatcacaccaggctccatgcccccccactccac

Exon 19 +      10400      10574   0   Internal    175    84        Good
agattcagcacctgggggccgatctccaccctggcgacgtgctactgagcaaccatccca
gtgccgggggcagccacctgccagacctgactgttatcacaccggtgaggggtgctgccc
gcctgcctctgctggggcagtggtggccgatgcagctgaccgtggctctccacccgctag
GTGTTTTGGCCGGGTCAGACGCGGCCTGTGTTCTATGTGGCCAGCCGAGGGCACCACGCA
GACATCGGGGGCATCACACCAGGCTCCATGCCCCCCCACTCCACCATGCTGCAACAGGAG
GGTGCCGTCTTTCTGTCCTTCAAACTTGTCCAGGGGGGCGTCTTCCAGGAGGAGG
gtgagtgggagtggggtggggcaggccttctgtaggctgggacacatggccactgctggc
aagcaggcctggctggaccgtgggatgcagcccataggcccaggcctgccttgaggctgg
gaggagataggtggttaccccaaagggcagctgcagatcggatcccgggagctgagatga

Exon 20 +      11742      11926   1   Internal    185   100   Excellent
ctgcctcagaggggaccctgagccaggctcaaggagaggggctttcctgaggtgctgagc
agtcccaggccaggcctcggtgctttctaggggccagagaccttgtctggatctgggaaa
cctgggttgggggtgcagacagggttggccaggggctcagtgatgacactgtccatccag
CGGTGACGGAGGCCCTGCGGGCGCCAGGCAAGGTCCCCAACTGCAGCGGAACCAGAAACC
TGCACGACAACCTGTCGGACCTCCGTGCCCAGGTGGCAGCCAACCAGAAGGGCATCCAGC
TGGTGGGGGAGCTCATTGGGCAGTACGGCCTGGACGTGGTGCAGGCCTACATGGGCCATA
TTCAG
gtgggcctgggcacaggagtgtgggcggcagggccatcctgcaggtgacctggccaccac
tgatcctgctccctgccaggcaaacgctgagctggccgtgcgagacatgttgcgtgcctt
tggaacctcccggcaggcccggggcctgcccctggaggtgtcctcggaagaccacatgga

Exon 21 +      12006      12152   0   Internal    147    93   Excellent
gtgcccaggtggcagccaaccagaagggcatccagctggtgggggagctcattgggcagt
acggcctggacgtggtgcaggcctacatgggccatattcaggtgggcctgggcacaggag
tgtgggcggcagggccatcctgcaggtgacctggccaccactgatcctgctccctgccag
GCAAACGCTGAGCTGGCCGTGCGAGACATGTTGCGTGCCTTTGGAACCTCCCGGCAGGCC
CGGGGCCTGCCCCTGGAGGTGTCCTCGGAAGACCACATGGACGACGGTTCCCCCATCCGC
CTCCGTGTGCAGATCAGCCTGAGTCAG
gtgggccgtggggagagtgcctctaggcggcaggggcacggtgcggccgctgacagcctc
tcccttccctcggggcgcgcagggcagcgccgtgtttgacttcagcggcactgggccgga
ggtgtttggtaatctcaacgcaccgcgggccgtaaccctgtccgccctcatctactgcct

Exon 22 +      12235      12379   0   Internal    145    98   Excellent
cccggcaggcccggggcctgcccctggaggtgtcctcggaagaccacatggacgacggtt
cccccatccgcctccgtgtgcagatcagcctgagtcaggtgggccgtggggagagtgcct
ctaggcggcaggggcacggtgcggccgctgacagcctctcccttccctcggggcgcgcag
GGCAGCGCCGTGTTTGACTTCAGCGGCACTGGGCCGGAGGTGTTTGGTAATCTCAACGCA
CCGCGGGCCGTAACCCTGTCCGCCCTCATCTACTGCCTGCGCTGTCTGGTGGGCCGCGAC
ATCCCACTCAACCAGGTTCGCAGGG
gtgtgtgcgcgagggggggccccagcccgaggtcaccctgagtgcgcctcctgggcccag
ccacggtctgaccccacgggtgctggggcggggggtggggtgctgtttctcccggagccc
accccaagagctcctgagagccgcccgccccgcacagggctgcctggcgccagtgcgcgt

Exon 23 +      12537      12686   0   Internal    150   100   Excellent
cccactcaaccaggttcgcaggggtgtgtgcgcgagggggggccccagcccgaggtcacc
ctgagtgcgcctcctgggcccagccacggtctgaccccacgggtgctggggcggggggtg
gggtgctgtttctcccggagcccaccccaagagctcctgagagccgcccgccccgcacag
GGCTGCCTGGCGCCAGTGCGCGTGGTCATTCCCCGAGGCTCCATCCTGGACCCGTCGCCC
GAGGCGGCGGTGGTGGGCGGCAACGTGCTCACGTCGCAGCGCGTGGTGGATGTCATCCTG
GGGGCCTTTGGGGCCTGCGCCGCCTCCCAG
gtgcgggggcggggtgggcgcagctcgggggcggactgggtgggcaggctggagtaggag
cgggagggcgaggtggggacgccctgccccagcccagcgcagcgaccaggtgccctcacc
agggctgcatgaacaacgtgaccctgggcaacgcccacatgggctactacgagacggtgg

Exon 24 +      12809      12966   0   Internal    158    91   Excellent
gtcgcagcgcgtggtggatgtcatcctgggggcctttggggcctgcgccgcctcccaggt
gcgggggcggggtgggcgcagctcgggggcggactgggtgggcaggctggagtaggagcg
ggagggcgaggtggggacgccctgccccagcccagcgcagcgaccaggtgccctcaccag
GGCTGCATGAACAACGTGACCCTGGGCAACGCCCACATGGGCTACTACGAGACGGTGGCG
GGCGGCGCGGGCGCGGGTCCCAGCTGGCACGGGCGCAGCGGTGTGCACAGCCACATGACC
AACACACGCATCACCGACCCTGAGATCCTGGAGAGCCG
gtgagcggcgtgcgcggaggctgggggcacggccgggtgggagccggggctcgggccacg
ctgagtctttgccctcgtcctcgccctcgcaggtacccggtcatcctgcgccgcttcgag
ctgcggcggggggctcggggggcagaggccgcttccgaggcggcgacggcgtcacccgcg

Exon 25 +      13059      13221   0   Internal    163    75        Good
gcgcgggtcccagctggcacgggcgcagcggtgtgcacagccacatgaccaacacacgca
tcaccgaccctgagatcctggagagccggtgagcggcgtgcgcggaggctgggggcacgg
ccgggtgggagccggggctcgggccacgctgagtctttgccctcgtcctcgccctcgcag
GTACCCGGTCATCCTGCGCCGCTTCGAGCTGCGGCGGGGGGCTCGGGGGGCAGAGGCCGC
TTCCGAGGCGGCGACGGCGTCACCCGCGAGCTGCTCTTTCGTGAGGAGGCGCTGCTGTCA
GTGCTGACCGAGCGCCGCGCCTTCCGGCCATACGGGCTCCACG
gtgcgcggttccccagccctcgcggccctccccgcccccgcccccacccccgcccctggt
ctctctggactcctcgcctccctccgcagggggcgagcctggcgcccgcggcctaaacct
gctgatccgcaaaaacggccggacggtgaatctgggcggcaagacgtcggtgaccgtgta

Exon 26 +      13311      13408   1   Internal     98   100   Excellent
gacggcgtcacccgcgagctgctctttcgtgaggaggcgctgctgtcagtgctgaccgag
cgccgcgccttccggccatacgggctccacggtgcgcggttccccagccctcgcggccct
ccccgcccccgcccccacccccgcccctggtctctctggactcctcgcctccctccgcag
GGGGCGAGCCTGGCGCCCGCGGCCTAAACCTGCTGATCCGCAAAAACGGCCGGACGGTGA
ATCTGGGCGGCAAGACGTCGGTGACCGTGTACCCCGGG
gtaagggccgcggcctgtcctgtccccctcccctcccctcccctcccggccccatcccac
agagggggaacagttgcagacctgaccagaggccgagtttaatttggccccggaaggaaa
gggggcgcgtaccgggcctccgtggtccatgggggcgggtgatggacgctgcccggtggg

Exon 27 +      13665      13807   0   Internal    143    92   Excellent
cagacctgaccagaggccgagtttaatttggccccggaaggaaagggggcgcgtaccggg
cctccgtggtccatgggggcgggtgatggacgctgcccggtggggaggggactgcgcagg
tgacagggaggggccacgcctgcactgagcccgcctccccgcccccccccgcgccaacag
GATGTGTTCTGTCTCCACACGCCCGGCGGCGGTGGCTATGGGGACCCGGAGGACCCCGCC
CCACCGCCGGGGTCGCCCCCGCAAGCACTGGCCTTTCCCGAGCACGGCAGCGTCTATGAG
TATCGCCGGGCCCAGGAGGCCGT
gtgaggatcccgcaataaagatgccttaagtctcccggttctggggacgcagctacggcg
cctagttcgtgctccgagtcgtgtctgtgcgcgccagccgcgcgcccctcatctgtgctt
gccttaggaggacactgagactcggagctgcaggcgcactgcccggtggtccgtgagccc

--------------------------------------------------------------------------------