--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (12327 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (5 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1409       1605   1   Terminal    197    62    Marginal
agggagagcactttattacagaccttggaagcaagaggattgcattcagcctagttcctg
gttgctggccaaagtaagtagaactttgtaagtaatttgcagtgtactttgaaagtgggg
tataaattaaaaataaaatcaagtccccctactgactgaatggatcccctcttgtcctag
GCGACCCCAGAGAAACCTGGAAAACTAAATTCCAGGCCATAATGGAAAGGGAGGTCAGAC
ACGCCTCATTATACACACTCCCTTTTGGAGTTCAGGCACAACTGACCAGCATTAACATTG
AAACAGTGATCATAAGACTGTCAAAATGGACTGTTTGTGGGAATAAGATACCAAATTCCA
ATCTGACTCTGGTTTAG
catcacatgacaatagcagaccctgaaggaaatcaatatatttaatccccaaaatatatt
tctttgacacatattgaaatggtcttgcaaaaccatcttttatggggaaatttgctggtt
tctggctctgctctgattgaggagagaataaatgagagtctgacaccttaaaaatctgaa

Exon  2 +       2674       2766   0    Initial     93    41    Marginal
cagctgattagatggtgcccacccggattgagggtgggcctccctttctcagtccactga
ttcaaatgttaatttcctttggcaacaccctcacagacacacccaggaacaatactttga
atccttcaatccaatcaagttgacactcaatattaaccaccacacttgggaaacttgaga
ATGAAGACCCAACTTCCCAGTAAGTTACAGAAACTCATGTATTATTCCGAGGCCACAGTA
AAGAGTGGAGACTCAAAGCATGGCCAGAAACAG
gtaaattagttttagtggcaacacaggttaagagagagaggaaggaagaagctcggctag
caaaggtggccttgttatgtagacgaaccttttctcagaagcaaaagatggtaaatgttt
ctatccagatctttaaaggtgtcagactctcaatcgctctggatcctgggaaaggcttag

Exon  3 +       5534       5588   2   Terminal     55    55    Marginal
aataacatatataaagacatcagaatgataggaatatcacgcaatgttgaaaaacatact
agtaacaggtttaatataaatgtagaacaaataaagttgaacaccatttcatatttgaca
atgtttcctatatgattttaacatgccaaatacaccgaatatgtctgtttttggcttcag
GGGACTTAATATCAAAAAAGATAATGAGGTCAACAAGACTGAATTTAGAATTTGA
ttttggaaagtttgattttcttcagtccccactttgaaacttaaaacaagtttcatatat
taaaagccaaggtaatagctttggagagatttgggttacgggtatttagatagagacaga
tattgtggtggaaaaacaaattacaatcaccaaacaggtcattgtaaataagtcattcat

Exon  4 +       9954      10105   0   Internal    152    97   Excellent
gaacttatgcatgtaaaagggattcatgcagtagaaatactaacaaaagaattactatga
cagatacttataaccattgtgtttttacgtatttaaaatacgttatacctataattagtc
acacgaggaaatcaaatgctaaagtatgatatgtttttatgttttgtttttcttgcttag
GGGATCATGGACATTGAAGCATATTTTGAAAGAATTGGCTATAAGAACTCTAGGAACAAA
TTGGACTTGGAAACATTAACTGACATTCTTGAGCACCAGATCCGGGCTGTTCCCTTTGAG
AACCTTAACATGCATTGTGGGCAAGCCATGGA
gttgggcttagaggctatttttgatcacattgtaagaagaaaccggggtgggtggtgtct
ccaggtcaatcaacttctgtactgggctctgaccacaatcggttttcagaccacaatgtt
aggagggtatttttacatccctccagttaacaaatacagcactggcatggttcaccttct

Exon  5 +       9954      10832   0   Terminal    879    74        Good
gaacttatgcatgtaaaagggattcatgcagtagaaatactaacaaaagaattactatga
cagatacttataaccattgtgtttttacgtatttaaaatacgttatacctataattagtc
acacgaggaaatcaaatgctaaagtatgatatgtttttatgttttgtttttcttgcttag
GGGATCATGGACATTGAAGCATATTTTGAAAGAATTGGCTATAAGAACTCTAGGAACAAA
TTGGACTTGGAAACATTAACTGACATTCTTGAGCACCAGATCCGGGCTGTTCCCTTTGAG
AACCTTAACATGCATTGTGGGCAAGCCATGGAGTTGGGCTTAGAGGCTATTTTTGATCAC
ATTGTAAGAAGAAACCGGGGTGGGTGGTGTCTCCAGGTCAATCAACTTCTGTACTGGGCT
CTGACCACAATCGGTTTTCAGACCACAATGTTAGGAGGGTATTTTTACATCCCTCCAGTT
AACAAATACAGCACTGGCATGGTTCACCTTCTCCTGCAGGTGACCATTGACGGCAGGAAT
TACATTGTCGATGCTGGGTCTGGAAGCTCCTCCCAGATGTGGCAGCCTCTAGAATTAATT
TCTGGGAAGGATCAGCCTCAGGTGCCTTGCATTTTCTGCTTGACAGAAGAGAGAGGAATC
TGGTACCTGGACCAAATCAGGAGAGAGCAGTATATTACAAACAAAGAATTTCTTAATTCT
CATCTCCTGCCAAAGAAGAAACACCAAAAAATATACTTATTTACGCTTGAACCTCGAACA
ATTGAAGATTTTGAGTCTATGAATACATACCTGCAGACGTCTCCAACATCTTCATTTATA
ACCACATCATTTTGTTCCTTGCAGACCCCAGAAGGGGTTTACTGTTTGGTGGGCTTCATC
CTCACCTATAGAAAATTCAATTATAAAGACAATACAGATCTGGTCGAGTTTAAAACTCTC
ACTGAGGAAGAGGTTGAAGAAGTGCTGAGAAATATATTTAAGATTTCCTTGGGGAGAAAT
CTCGTGCCCAAACCTGGTGATGGATCCCTTACTATTTAG
aataaggaacaaaataaacccttgtgtatgtatcacccaactcactaattatcaacttat
gtgctatcagatatcctctctaccctcacgttattttgaagaaaatcctaaacatcaaat
actttcatccataaaaatgtcagcatttattaaaaaacaataactttttaaagaaacata

--------------------------------------------------------------------------------