--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (45730 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (17 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        401        530   2   Terminal    130    48    Marginal
gctgtgcggtggtgaccaacgcacccatgcgctgggtttcacagatgcagactgaagtcc
aggctctgctgcagattaacggggtggccgccagcaagtcaagtgacttgctcttctgtg
cactgcatgtacttgggttcctctcacaggtattcctgtttttcctctttcttgctccag
GTTACACCTCGTGGCGCGGCGCTCTCGGAGAGCCTGTGGAGTGGCCCTGTGTCCCTCCCT
GACCCCTGGAGGATTCCGTAAGGTCACAGTCACCGCCTCCATCCCCTACTTGCCATGTCT
TCAGGGCTAA
tgcataacaattatcacaatttacagcagccccacgctctgaagagcttctggaggggat
actactcaagcggaggaaggcaagacagggacctcctccctcttcccggacctcttctga
taaggaatatttgtaggtggttaagaaaggcagcgggagggcgtgaaggcaaagacaagc

Exon  2 +       1283       1464   0    Initial    182    78        Good
ggtgccggcggctgtaggcctcgccgcgcccacccagcctggggcgggcccagcctcacc
gcccggcccgccccgccccacgggccagccccgcgccgggtgtttccgctacttccctgc
ggcggggtaaccgcctcgcacctaccgggctcggttccctggctccggccgcgggggagc
ATGGAGTTTGCGGAGCTGATTAAGACCCCGCGGGTGGACAATGTGGTGCTGCACCGGCCT
TTCTACCCGGCTGTCGAGGGCACCCTGTGCCTGACGGGCCACCACTTGATCCTGTCCTCC
CGGCAGGACAATACGGAGGAGCTGTGGCTCCTCCATTCAAACATCGACGCCATCGACAAG
CG
gtgagtgcccgccccaccccagctccgcagggagccgggggtcccttgtgggcgccccgg
gaaatacttcctggcgttttccgcgcagcctgccgcccagctagccggcaagatgagccc
tctgtggcctagaatcaggatttaccaagctgaaacccgtccagatggaggacccggttt

Exon  3 +       9355       9576   2   Internal    222   100   Excellent
tataatggacctgaaaagtttctcttgcccagtgacgttgtgtttgtggtgatgccagta
taaacaacaaacctgggctgccagttacacaacaatgtagcacataccattgcatacatc
acataatatttataaacgatcataaaacgactttgttactggtttatgtatttactatag
TATACTTGTTATTGTTATTTTAGAGTATACTGCTTATACTTCTAAAAAGAATGTTAACTG
TAAAACAGCCTCAGGCAAGTCCTTCAAGAATTATCCAGAAGAAGGCATTATCATCACAGG
AAATGACAGGTTCATGTATGTTATTAATATTTCCCCTGAAGACCTTCCAGTGGGGCAAGA
TGTGGAGATGGAAGACAGTGACATTGATGATCCCAACCCTGT
gtaggcctaggctaatgtgtgtgtttgtgtcttaggttttaacaagaaagtttaccaaca
aaaattttttaattggaaaaagcttatagaatgaggatataaagaaggaaaatatttttg
tacagctgtatggtgtgttgtattttcagcttagtgttattacaaaagaggtaaaacgtt

Exon  4 +      11466      11528   0   Terminal     63    64    Marginal
cttaacacattagttacagatctttttcctattctttgaaataaggccccaaataatctc
catcagaacagttagcttaatgtgaattactttatatatttgaaatttaaaaaagacata
tattgtaagtaatgtatggctcacattttaatgatgcagccttgcttcttccttaattag
ACTGAGGAGAAGAAAGTTAATATAGATGGTAACTACAACTATATTCTCTTTTCAAAGAAA
TAA
taatatatttaaagttagtaatatatgtgttcctaaacatgatttgcaatttcttacaga
tttgtaggatcactgggtaccatcatcataaaatgtaaagattttcgaattattcagttg
gatattcctggaatggaggaatgcttgaatatagccagttccattgaggtaagtattttg

Exon  5 +      11588      11696   2   Internal    109   100   Excellent
ttgtaagtaatgtatggctcacattttaatgatgcagccttgcttcttccttaattagac
tgaggagaagaaagttaatatagatggtaactacaactatattctcttttcaaagaaata
ataatatatttaaagttagtaatatatgtgttcctaaacatgatttgcaatttcttacag
ATTTGTAGGATCACTGGGTACCATCATCATAAAATGTAAAGATTTTCGAATTATTCAGTT
GGATATTCCTGGAATGGAGGAATGCTTGAATATAGCCAGTTCCATTGAG
gtaagtattttggaagcaaaatctaatgaaacataattttatattatgactcagtgtagc
tcttccatttcttcattagataatttagtcatgttctctgactcaaatactgaagactga
taggaaaagcctcaccctggttcatcgtcatatgagtgtaatggaactttcttgacttcc

Exon  6 +      14010      14117   0     Single    108    40        Poor
actgttaaattgaaataatgtcccactatttgggcatttgggcagaggaacattacccac
ttccattgagcatgtatgtgtttgtgggttttgtggtttttttttttttcagttaggaga
ttggattttcactgaccagtcttcgtttttcttattcctttgtgagaattgatctgtaag
ATGACTGGCTGGTTGGTGTCAGAGATGCTGCCTGTGGTGAGGCACAGTGGTGAAGGAAAA
GGGGAAGTGTGCTACCCACTTGCTGACGCTGATCAGTTGTTTAAGTAG
ctgtatatattttaaaactctttagaaactgactcattatataaaagcccttaggactga
aaagaagccgtaaattatgagctcatttgacctcagaaaatgaatgctctgttaaatgtt
cttacagcgtagtgattaacatagtgaacctgtcctctatccttttcctggcacagaatc

Exon  7 +      15332      15445   0   Internal    114    66    Marginal
cataatccccctgtgagaaggatgaatctgcctagtgatagagactttccttctctctgt
tcctcccatctactcaggttttcctatgtctgttttccaggattcaagtgctccaggtaa
atataggcccatttggggctgatagagttattgcccccatttgagaatggatccctgcag
CATGAAAATATGATGATACATGACCAAATGGCATATACCAGTCTAGGAAGAGAGGAAATG
AACATTGATGGAATTTCTACCTATGTAGAGCATGTCATAGCTGAAATTGGCCAG
gtgcggtggctcacacatgtaatcccaatactttgagaggctgaggcaggcagatcacct
gaggtcaggagttcaagtctggcctggccaacatggtgaaaccccatctctactaaaaat
acaaaaaaattagctgggtgtggtggcaggcacctgtaatcccagctactcaggaggctg

Exon  8 +      16417      16546   0   Internal    130   100   Excellent
aagcaaagaaatcagcttcagtaagactaaaattgtatctggtgataaacacaatgttag
agaaacattctgggtgcccatcattattagaccatgtttgcttaatactaatttgtcagt
tagaatatgtttccagttgtggatgtttcttttttgtctttcttttctttttgcccccag
GCATTGTCTACTCTGGACTCCATCACTCTGATGTACCCTTTCTTTTACCGTCCTATGTTT
GAAGTGATAGAAGATGGCTGGCATTCCTTCCTTCCTGAGCAAGAATTTGAACTCTATTCT
TCAGCTGTGA
gttaacttttgagaactgtggattatgagaagtaacccaataccttatttgacttgtgaa
aatgatcacttcttttgaagagtaataaggtgaagttgacttatccattcctaatcttaa
tatatttaaaaggattgaagccatgcagagtatgatctctgatcacaaaggaattagatt

Exon  9 +      19614      19715   1   Internal    102    80        Good
tccgatttataaagtcaatacaatcttaataaaaaccccagttggtttttatattgaatt
tgataaaagttgcatggaagaccaaaagaccaagaggagccacgttactctttgaagaac
aaaaaggtgagaggaggacacttggcctactagataccaaacttattttaaaagctatag
GAGTTACTAAAGTGGACAAGTGCGACGGGATGGAGAGCACAGTACATTTGGACCAACAGA
AGCGGCATTGCAGATCAATGGAGAGCCCTGTCATTCTCCAGA
gtaggaaatcaataataatatatcatagtgaaagttcaagaaataacagtattatcatgt
tgtttagaaatgtaaaggtaaacactgaaaaagctaaaaatgttgaaaatgattgccttt
ggggaaagcaaattgggatgggctagcaaggaacagataactacatttttttaaaaataa

Exon 10 +      21235      21408   0   Internal    174   100   Excellent
aaccatagagctccttttctctgcagctacttacatataagctagagatccacctgtgaa
attcctgagaaatggcttcttcatcagtgaaagttgacctctaaggtcttttaaaatttc
tcagattattttgcgacattgagatagttgcttagctttgaagtattttgtgtttttcag
ACCAGTGAATGGAGGCTAAGCTATGTCAATAAGGAATTTGCTGTCTGTCCCTCTTACCCA
CCAATTGTCACAGTGCCCAAATCCATCGATGATGAAGCTCTTCGGAAGGTAGCTACATTT
CGACATGGAGGGCGCTTCCCAGTACTAAGCTATTACCACAAAAAAAATGGGATG
gtaagtgcacagcactactgcttgatgtactgaaaggcttgggttggggatcttttcgta
gaaatgttcccttttgctctctgtctgttcactgaaatgattgtccaggtctccaccaca
agggcttccttcatgtaagctttagggaatcaggagtagggtgttttctgtggtgaggat

Exon 11 +      22584      22801   0   Internal    218    99   Excellent
tcttttatagttattaactattgtcaatacatgcaaatatttctttgtttatggatcaaa
tccatctgcagagtgtcacacaattgtttttgagatactcttaatctagctaatttcttt
ctgttttcagaaactttaaaagcaactgctgttgaattttcagctttattatgcttctag
GTAATTATGCGAAGTGGTCAGCCACTCACTGGTACAAACGGGAGGAGGTGCAAGGAGGAC
GAGAAGCTGATAAATGCTACCCTCAGGGCTGGAAAGCGTGGCTACATCATTGACACCCGA
TCCCTGAACGTGGCTCAGCAAACTAGAGCCAAAGGAGGTGGCTTTGAACAAGAAGCTCAT
TATCCTCAGTGGAGGCGAATTCATAAGTCCATTGAGAG
gtaaaagattccaaagatagtacagactcttattagaagctaattatagtgggtaaggcc
ttagccatttgaaaatcacaagtgctcaaattaacttctgcattaatttagggtcaatga
tgggctagccatcttctcatttttttttggtcagctctattaaggtttgattgacaaata

Exon 12 +      25937      26082   0   Internal    146   100   Excellent
ttagtttttcaacctttaatcctcaaattatagcagggtaaatatttttatagtattttg
aactacttttgctcttagatatgttggaggctgaatctttggtttggtttctttatcttt
ctattttctgggtttgttattttttactttcttacttttaaaaggtatcacattcttcag
GAGAGCTTAATCAAACTTGTGGAAGCTTGTAATGACCAAACACATAACATGGACCGATGG
CTCAGTAAATTGGAGGCCTCTAACTGGCTGACTCACATCAAAGAGATTCTGACAACTGCC
TGCCTAGCGGCTCAGTGCATCGACAG
gtaaagtgcatttcagcgttcctgagcgaaacatggcgctgctaactagactttgtgttt
atccagacatatgtttatagattatgtgaaagtttgcagtaaattactgtgtaggctagt
caacaccatcccattattgatgaggtgtgtgcctagagtctggcatttaatagataatgt

Exon 13 +      29983      30079   0   Internal     97    59    Marginal
gcacttttaatttccatcaggaacttctcctttgcattcacaacttgattaactagtgca
ggaggcccagcttttggcctgactcagctttcgacgtgccttcctcactaagcttaatca
tttctagcttttgatctaaaatgagacatgctactcttcctttcatttgaacacttacag
GCCATTGTAGGGTTATTAGTTGGCTGGCCTAATGTCAATATTGTTGTGATCCCTGGAATA
GAGAGTCTCCCTGAAGAGAGAGTCAAAGGAACAGCTG
gttagtggagcagtgagaacacacacagcatttgttgattaagttcactgtcttatatgg
acgtggttcctgatgcccccaaaacttgtagaagtaacatcaaagatcactgatcacaga
tcaccatagcagttgtaataataatgaaaaattttgaaatattgtgagcattactaaaat

Exon 14 +      31317      31458   2   Internal    142    96   Excellent
cttagatttagatttagattctgaactctacaagtcagagcagaatgttgtactcaatac
actaaataaactgaactcagtagactaaaatgttgtgctcaataaacgcttgttattaac
agagttcattgaccatgttggacatttcccatttgtactcttccctgattttcctatcag
GGAAGGAGCATCAATATTGATTCACGGAACAGAAGGAACTGATTCCACACTCCAGGTGAC
CTCCTTGGCCCAGATCATCTTAGAGCCAAGAAGCAGGACCATTCGTGGTTTTGAGGCCCT
GATTGAAAGAGAGTGGCTGCAG
gtgagaagagctgtttgattcacagaggaactgcttattgatgctgtgatcctgctttgt
gtggtagctgacataatgtgtgaaatttcgattgattaaaatttctaagttgtgtgttta
atttactgcaggacagttaatctgtcttctccttgtttctggatgtctctttgcctgtat

Exon 15 +      33067      33287   0   Internal    221   100   Excellent
tagttgctgccgctatttattttataccaagaaatcattaatctgtacaacagctaccct
aattatatgatgttccaggtactaggagtgtcactgtaattgtgtatagtggtgtcggta
gaatgctctgtcatgtgatctcaccaggatatgactgtcacgcctccatcttccccctag
GCTGGTCACCCATTCCAGCAGCGCTGTGCACAGTCAGCCTACTGTAACACCAAGCAGAAG
TGGGAGGCTCCTGTATTTCTTCTCTTCTTGGACTGCGTGTGGCAGATCCTTCGTCAGTTT
CCCTGTTCTTTTGAGTTTAATGAGAATTTCCTCATCATGCTCTTTGAGCATGCTTATGCC
TCACAGTTTGGAACATTTCTGGGCAACAATGAAAGTGAAAG
gtgagtacactgctcacatggggacctttccttttccgttgttttggctacttcctaagt
agccagaatctcctaggagacgacgatttggatctatattaaaattatttataaaaaggt
agaggctacagttaattataatttaaatgacctgaagtatattcttttatgagagcatgt

Exon 16 +      36081      36214   2   Internal    134    57    Marginal
gttctaatgccgattgagctttttgacaaatctattgatttttcaacactttgtttctct
accaaaagtcttgtattctatcttctttcatactgagaagaaattgtcctcgtaagagga
gcactcaataatggttgttataaattaattactttaatggcagtgttctttcttgatcag
ATGTAAGTTGAAGCTACAGCAGAAGACGATGTCTTTGTGGTCCTGGGTTAATCAGCCCAG
TGAGCTGAGTAAATTCACCAATCCCCTCTTTGAAGCCAACAACCTTGTCATCTGGCCTTC
AGTTGCTCCGCAGA
gtcttccactgtgggaaggtaaaccacgcatcctttgcaaacttcttaacggtcaggtgt
gcatgcggctgcctgtgagtgtgtgctgttggtgatgtatgaagatggtgagctggacgt
ggccctcagacctgtgtgaattgtcattctcagtgtgggcatgtttttctctttcaaatc

Exon 17 +      39019      39174   1   Internal    156    94   Excellent
atccttttcagtacctcaagattcctgtatattttagagtataataaaatacagatgtga
gttgtggcaacaaaagaaaaaagaatgtataatacataaattacatcttatccacaaatg
taattttaatccattgtatatacctttcttgcttctgttttccattcctggattcaatag
GTATTTTCCTACGTTGGAATAGATCCTCTAAGTATTTGGATGAAGCATATGAAGAAATGG
TTAACATCATTGAATATAATAAAGAATTACAAGCAAAAGTCAATATCCTTCGAAGGCAGT
TGGCAGAACTGGAAACAGAGGACGGGATGCAGGAGA
gtccctgaaaggtctcctcgcacccttcgcaaggaccttcttgggcctgtgtccgccgtt
ctctccttgtgcccttcagttcacttttacacggtagccttgaagtgaaggctttagatg
tgggacccccctaatgtaatggatttctcaatactgtatgaataatgaaacttactatca

--------------------------------------------------------------------------------