--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (72586 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (9 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       9615       9812   0   Terminal    198    74        Good
ttttagtgtagctatagcataaatgataaagtagaaaaatgatatctttataaagtaccc
acatattgttaactattaggtcagtataatatctctcatcaaagatttttaatgtcaagt
ccataatactttgagaggaaatgactaatttctcccattttttaaaataatacttttcag
ATATTTCAGTTGAAGGAAGAAATAGCTCTTCTCCTAAGATGGAATCTGTGGTTTGGGAAT
GTGGTTGATCAACTTGATATGTTGGCCAAATGTGCCCCATGTAATAAAATGAAAAGAAGA
GACAAGATGATGTCATTTTCCCATATTGTGAAACCAAAAACAAACGCCTTTTGTGAGACC
AAGCTAACAAACCTCTGA
cggtgcgaagagtatttaactgtttgaagaatttaacagtaagatacagaagaagtacct
tcgagctgagacctgcaggtgtataaatatctaaaatacatattgaataggcctgatcat
ctgaatctccttcagacccaggaaggatggctatgacttggattgtcttctctctttggc

Exon  2 +       9959      10147   0    Initial    189    83        Good
cgccttttgtgagaccaagctaacaaacctctgacggtgcgaagagtatttaactgtttg
aagaatttaacagtaagatacagaagaagtaccttcgagctgagacctgcaggtgtataa
atatctaaaatacatattgaataggcctgatcatctgaatctccttcagacccaggaagg
ATGGCTATGACTTGGATTGTCTTCTCTCTTTGGCCCTTGACTGTGTTCATGGGGCATATA
GGTGGGCACAGTTTGTTTTCTTGTGAACCTATTACCTTGAGGATGTGCCAAGATTTGCCT
TATAATACTACCTTCATGCCTAATCTTCTGAATCATTATGACCAACAGACAGCAGCTTTG
GCAATGGAG
gtaagacttgatctattctttgacgtatcttagtaaatgactcttgtgttgtcccatcag
ccaatctaatgaatgtgtttgataaacaacaggaaaataatatgctattttaaattatat
cttataaatttaaaaatgtatatgttttgcttcagactctaatagattgaagaattcaca

Exon  3 +      27583      27779   0   Internal    197    58    Marginal
tagaatcttcaagggtagggctaggacagttttgtttaaaaaaacaaaaactccccttca
gaaaattttaataaccctcagaattttcttgtaatgagaaagagaatgttgcagtattat
agaaagctttaacttgtatacagctctttaactaattattcaattttaacttttccctag
CCATTCCACCCTATGGTGAATCTGGATTGTTCTCGGGATTTCCGGCCTTTTCTTTGTGCA
CTCTACGCTCCTATTTGTATGGAATATGGACGTGTCACACTTCCCTGTCGTAGGCTGTGT
CAGCGGGCTTACAGTGAGTGTTCGAAGCTCATGGAGATGTTTGGTGTTCCTTGGCCTGAA
GATATGGAATGCAGTAG
gtgcgaaaatcatagattttcatggatcatttcttatgttgcaatatgtttaaaagtact
tgtcttcttttccatctgttttaaaaaactttttttgaagtgtacatattagtcattaat
tttgaacagttttatggcctcacaattgtttatttgcttagaaatttggaagcactaaat

Exon  4 +      34092      34248   2   Internal    157    60    Marginal
tcgaaaatctagttgtatggaccacaaacaagatatcaccatttactttatttctacata
ttacatttgctctccaggaataaataaggttgtgagtgccagatttggaaatccaaactg
ttagatcgtgatagatttccccataagtaaaaatagttctcatcttgttttgttttttag
GTTCCCAGATTGTGATGAGCCATATCCTCGACTTGTGGATCTGAATTTAGCTGGAGAACC
AACTGAAGGAGCCCCAGTGGCAGTGCAGAGAGACTATGGTTTTTGGTGTCCCCGAGAGTT
AAAAATTGATCCTGATCTGGGTTATTCTTTTCTGCAT
gtgcgtgattgttcacctccttgtccaaatatgtacttcagaagagaagaactgtcattt
gctcgctatttcataggattgatttcaatcatttgcctctcggccacattgtttactttt
ttaacttttttgattgatgtcacaagattccgttatcctgaaaggcctattatattttat

Exon  5 +      34902      35109   2   Internal    208    75        Good
cggaactctaaccatcatccttttagcgatgaataaaattgaaggtgacaatattagtgg
cgtgtgttttgttggcctctacgatgttgatgcattgagatattttgttcttgctcccct
ctgcctgtatgtggtagttggggtttctctcctcttagctggcattatatccctaaacag
AGTTCGAATTGAGATTCCATTAGAAAAGGAGAACCAAGATAAATTAGTGAAGTTTATGAT
CCGGATCGGTGTTTTCAGCATTCTTTATCTCGTACCACTCTTGGTTGTAATTGGATGCTA
CTTTTATGAGCAAGCTTACCGGGGCATCTGGGAAACAACGTGGATACAAGAACGCTGCAG
AGAATATCACATTCCATGTCCATATCAG
gtaagggaaaccttgttacaaatttcagaatatatgataatgaaacaaaagcatattact
ataatgagttaatatcagctgttttttgaaatgtcatgaaccttcaacttgtacattaac
attttaaggatgagatgacaaatatgttgtagtaaatatgtaatacacatatttgataga

Exon  6 +      40751      40812   0   Internal     62    64    Marginal
ctttatttattgaagtttgggtatccctgggtttttgttcttcacagaaaggtcccctca
caaagctgatggaaagggatgttttttaccctaacatctcatgggttagtaacacttgga
tacgttttaaaaattccctccaacgtgtatttttttttctaggatttcctttctctttag
CATAATAATTCAGAGACTGTTCTGGAAGATAGTGCTGGTGTGGCTAAAGTTTTATTCTAT
AT
gtgagtcccatgaattcctttgtgattcttgtgctttccaatcttgcttccataaataga
tgttgagttaaacctggcctgttcaaaaaagataaagtactataaacatgaactcttatt
tgtatagacttcattgtgggtaaaatctgtgattgctgatatccacaacaaccttttcaa

Exon  7 +      62683      62916   2   Internal    234    96   Excellent
attgacatagattgttgttctattctttcctctgtcaacaatgtttcttcatgtcagtcc
tatagatctaatttggcaagcaattaatttcaagaataatatcagtgtttcagagaagta
ttgcttattggtctgaaggaagattggtatgtatcttaaacttactattttgttgtctag
GATAGTGAATGAGAGCCGACAGGTACTCCAGGAACCTGATTTTGCTCAGTCTCTCCTGAG
GGATCCAAATACTCCTATCATAAGAAAGTCAAGGGGAACTTCCACTCAAGGAACATCCAC
CCATGCTTCTTCAACTCAGCTGGCTATGGTGGATGATCAAAGAAGCAAAGCAGGAAGCAT
CCACAGCAAAGTGAGCAGCTACCACGGCAGCCTCCACAGATCACGTGATGGCAG
gtgagttttgttagtagtgtagtttatttcataagctgaattatgaccatacagcttaag
aaagaggagcagccaattctgaaatagaagtcgaacataattaagcctttgaactttgct
agatagagttgtcccagactatggtcagacttaaagtcagtcagaattgtttagatttga

Exon  8 +      66485      66575   2   Terminal     91    77        Good
ttatcattctttttgttactatctattttccacataattgtctttcctcagctaagtttg
cagcttctagagaataagaactaggtgacaccgtattcctccacagtatctagcacagta
ctaggcatatatatatatagtaggggattaacaaatctatcaaataaataatgactttag
AAATAATGTGGATGTTTCCCAGAAATGCAAGAGCCAGAATGACAGTGGCACCCTACTGAA
GGTGTTCTGTAATGTGGCACATGAATACTAA
tactgtaggactcttggctgtacccagaactttagggcagatttgagagattccaagact
gtggtgaaccagaagtctgaacaaggattttcataatttgaaaagccatctcatggagat
ttccttctgcttcagtcagtttttaactttgtgtgtcaacactatgttgtggtcattttc

Exon  9 +      69743      69956   2   Terminal    214    78        Good
ttggccatgtcaataattctacagtgttaacgaagttaagcaatcaaaagttggttatta
ctttctcatggttggtttcctaataatttcccttactgaggcatttttatgaaaattatt
agtgttattatattttctagtgtgttctgttacccacttcaaaataaactctcatgacag
GTACACGCCCTGCAGTTACAGAGGAATGGAGGAGAGACTACCTCATGGCAGCATGTCACG
ACTAACAGATCACTCCAGGCATAGTAGTTCTCATCGGCTCAATGAACAGTCACGACATAG
CAGCATCAGAGATCTCAGTAATAATCCCATGACTCATATCACACATGGCACCAGCATGAA
TCGGGTTATTGAAGAAGATGGAACCAGTGCTTAA
tttgtcttgtctaaggtggaaatcttgtgctgtttaaaaagcagattttattctttgcct
tttgcatgactgatagctgtaactcacagttaacatgctttcagtcaagtacagattgtg
tccactggaaaggtaaatgattgcttttttatattgcatcaaacttggaacatcaaggca

--------------------------------------------------------------------------------