--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (58244 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (25 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1450       1531   1   Internal     82    68    Marginal
gccgcagcgcgcggaggaacccgggtgtgccgggagctgggcggccacgtccggacggga
ccgagacccctcgtagcgcattgcggcgacctcgccttccccggccgcgagcgcgccgct
gcttgaaaagccgcggaacccaaggacttttctccggtccgagctcggggcgccccgcag
GGCGCACGGTACCCGTGCTGCAGTCGGGCACGCCGCGGCGCCGGGGCCTCCGCAGGGCGA
TGGAGCCCGGTCTGCAAGGAAA
gtgaggcgccgccgctgcgttctggaggaggggggcacaaggtctggagaccccgggtgg
cggacgggagccctccccccgccccgcctccggggcaccagctccggctccattgttccc
gcccgggctggaggcgccgagcaccgagcgccgccgggagtcgagcgccggccgcggagc

Exon  2 +       3483       3576   0   Internal     94    79        Good
tctggattgcgcagtaaagaggcatcttgggagatggggccaaggttttagggggtgcca
ctcgcgaacggttcatccgctagactaggggggctctttggctgtgcgtctggccagaac
tggccttgacgatggaagtttctggaaccaaagcgttgctttctctcccttgtgttatag
CTGGAGCTGCGGGAGCGCCTGCCCTGCCCGGAGCCCGCGGTCCCCTCTCGGCTGCCCCGC
GGTGGCGTCACGCGCCCCTCCCGGAGCAAGCCCG
gtgcgcagggccgggggcgtgggcggctgctgccagaggcgctctctgtgtgtttttaag
gactgatttgggccgcatcccccggaaactaaagtggggtgttttaccgtttaaataacg
gctacaggtttgaaagcggggttggattttcgagttgtgtttggtaatagtctttgaggc

Exon  3 +      12285      12359   0   Terminal     75    49    Marginal
acacccagccaggacctatgatctaattcattgttggggtagcttcacaattttcttctg
gacgccttagtaagtccacactttaagcagccaccacatggcatactttaccttctgttt
ttcctttcccctcccctacctagaccctcctaacttttggggtttttttcctttcctcag
GGTCAGTTTGAAAAGGAGGATCGAGCTCACTGTGGAGTATCCATGGAGATGTGGAGCCTT
GTCACCAACCTCTAA
ctgcagaactgggatgtggagctggaagtgcctcctcttctgggctgtgctggtcacagc
cacactctgcaccgctaggccgtccccgaccttgcctgaacaaggtaaggtgctggctgg
gggcagcctggactcctgggccttgggaacaggatgggctgggagggaggtgatatggtt

Exon  4 +      15514      15700   1   Internal    187    72        Good
actggagactgagatgagagtgtaaagggagtgagtcagagtgggaggtttgaggggagt
ttagatttgaatccgccaattgtagacagcgataaaggagtggaagagtagcaaggagct
agttgaggtttgagaatgtgaatttataatggagcctaaagtactttcttttttttgcag
CCCAAGAAGGGAGAAGTGGATCTCGGGCCTGGCTGCTTGTGAGCCAGCCCGACGGGATGA
GTATAAGGAACTTTAGGGCCAGGGTGGGGGTGCTAGTAGAGGAGGGGGCTTCACGGAAGC
TGCTGGGGCAGGGTGGAGGCTGGAACCTGGGGGCTGAAGATCTTGATGAGGACAAAGTAC
CGGCCCT
gtgaacagaagaaagggagtaagagaggtggatggggctcttaggagccatgtacccagg
aagactgacattaaatgaccattttttaaaaatcaacttaattttcaaaggcacattggc
tcccacctataatcccagtactgtgggaggcagaggcaggaggatcacttgagcccagga

Exon  5 +      29446      29513   2   Internal     68   100   Excellent
tcggggggctggtggacgccattggccctgggtgtcaggccctgctaattgatttggtgc
tcccggctctctttccacacatacctgtgccccccatttttgcagctctccttctatttg
gggactccgagagttgagagaaacacatttttggggctctctccacccaaacccttgtag
GATGGCAGCTGTGACCCGGGATTTCGGTGAGATGCTTCTGCACTCTGGCCGGGTCCTGCC
AGCCGAAG
gtaagttttcagttccatttcaaagccaaaatacgtaataaaaaaacctctgcagagggc
ccccggagccccgctgcgctgttctgtgctccttttaagttgctttcaaagccaccccga
gttcctcccccacccacaattgccccctcatttatctctggggagtttataccaagactg

Exon  6 +      30997      31125   0    Initial    129    44    Marginal
ctgccacatttggacagccgagcctgctggactcgcaggggcaggagagtgcattttata
attaaaagcactcaactgtaaggtaatgattgatatgagctatgggcttgaggaaatgag
ggaaggaggggaggataaggccaaagcaaccaacttcagaatctcacgggaggaggtagg
ATGCAGGGGGTGCCATTAGACAGAATCAAAGGGCTGAACCAGAAGGGCTTCCTCACCTGG
GGAAGTCAAGACACTGTGAAGATTGAGGCTGCCTTGCACAGCGGTAAAGCTGGACTCTGG
ATGTATGAT
gtatgtggattctggagaaccaggctacctgtgtttgaatcccagctctgccacttaaca
acctagctgggccatcttggactaatcccaaatctttctgtgccccagtttccccctctg
aagataataattcctttttttttttttttttgagacggagtctgggtctgtcacccaggc

Exon  7 +      33283      33377   2   Internal     95    68    Marginal
ttgaggattatcaaaaagtgtgggtctccggtgggctcctaattccttcttaggggatag
agacaccttagagaagcagggtaggtttgatgtatgaatccttgtcactcgcactaaaag
gagcactggttgcagcctgcacaaattcccaaggtccacccgccagctgctttgacccag
GAACCTGCGTGGTAATGAGATCAGCAGCCTGAGTTCTCGAACGATGTTCAAGGCAAACCC
TAACCCTGACCTTCCCACTCCTGTTGATGAGAACG
gtgactccattctattggcatcaaagcataaggccccttttttttcacaatgcacttttt
ttgttgttgttgagacagtgtctctgttgcccaggctggagtgcagtggcaagattatag
ctcctgcagccttgagttcctgggctcaagggatcctccctcctctgcctcccaagtgcc

Exon  8 +      39871      40137   1   Internal    267    89        Good
tccccactgacccatgctccaattcccactgccctggctcagtagcctccagtaagtgat
gcccaggatggtgcggctccgtgtggccagcgtaattccctttgtctctcccctcctccc
ctctccctgtcttcctctctcgccccttggcttcccttcccggccccgtggtggctgcag
CCCAGCCCTGGGGAGCCCCTGTGGAAGTGGAGTCCTTCCTGGTCCACCCCGGTGACCTGC
TGCAGCTTCGCTGTCGGCTGCGGGACGATGTGCAGAGCATCAACTGGCTGCGGGACGGGG
TGCAGCTGGCGGAAAGCAACCGCACCCGCATCACAGGGGAGGAGGTGGAGGTGCAGGACT
CCGTGCCCGCAGACTCCGGCCTCTATGCTTGCGTAACCAGCAGCCCCTCGGGCAGTGACA
CCACCTACTTCTCCGTCAATGTTTCAG
gttggtagccaagccctgcccttgcccctccctagacccaccccctccagccctctctgc
cagtttcagaggaaggtgaacctcctccccctccgtgatctgcccccactctgcttcaga
aactgctgcccactaacattgctccctgcctgccgcgtggcttggctctcagagaggtga

Exon  9 +      41384      41473   1   Internal     90    98   Excellent
caaacacgcacaggaactgttcttaaacagtttccatcccaccaagagatcatcactaag
ggagcagtgggactgggatccccatggggagggtgtccgtgttcatctggaactgcacta
gccttggtgaaatctaggggtccctaggaggaacctcagtgccccttcttcttcccatag
ATGCTCTCCCCTCCTCGGAGGATGATGATGATGATGATGACTCCTCTTCAGAGGAGAAAG
AAACAGATAACACCAAACCAAACCGTATGC
gtgagacactgtttcctatcttactgccctttgggtctgggcattgggtttaagagggga
ggggaaggctgaaaggggaggaagaggagggcacatggggtcacggtgcctgttctgcta
agtgccaggcactgctcacaggtgttgggcagatgggcaagacacctccaggtcctggcc

Exon 10 +      41753      41898   1   Internal    146    81        Good
gtcacggtgcctgttctgctaagtgccaggcactgctcacaggtgttgggcagatgggca
agacacctccaggtcctggcctgggccctgctcctgagcctgaccagctgctcctctcca
ccctgcctgtctctcttggctttccccgggcagccgtagctccatattggacatccccag
AAAAGATGGAAAAGAAATTGCATGCAGTGCCGGCTGCCAAGACAGTGAAGTTCAAATGCC
CTTCCAGTGGGACCCCAAACCCCACACTGCGCTGGTTGAAAAATGGCAAAGAATTCAAAC
CTGACCACAGAATTGGAGGCTACAAG
gtacgtgtgtgtgcatgcgaaagttagagtaatgggaacaggggaggccgagttaggaag
tcctgattacatgcttttcatttttttaagtaatactttccacctatacaggttattcat
taaaatttttaaatacaaaaaaatgcaaataaagtttaaacatttcttcagtcttctttc

Exon 11 +      43574      43697   0   Internal    124   100   Excellent
cagagtgtgaacgggctggtaggggggcaatccacgccttgtcctagccaaccctgcagc
ctggggccctgtgccaccaggctctgatatggagggcaggtgccacggggtgccgacatt
gtcatggggcctgcattttcctctggaccctcaatgtatccctttggcatttcccctcag
GTCCGTTATGCCACCTGGAGCATCATAATGGACTCTGTGGTGCCCTCTGACAAGGGCAAC
TACACCTGCATTGTGGAGAATGAGTACGGCAGCATCAACCACACATACCAGCTGGATGTC
GTGG
gtaagagggcagaggcagcaggaggaatgagtttagtgggaagagccaggcttggagaac
acagccggggtgtccaggtttcttaggggcagagtcaggatagcgattggcacttcttgg
ctttgtcaccttgagcaggtcacttctcccttttgagcctcacttttcttatctgtaaaa

Exon 12 +      45153      45361   1   Internal    209    89        Good
tctgttttgagaggcttgggctcagcagaagtgctgggaggtttacaacccatcactggg
aaagccaagtggggcgcaggtgagcccacccctctttagccatggcaaggtccccatgac
aagtgcctcctctcccatcttccacagagcggtcccctcaccggcccatcctgcaagcag
GGTTGCCCGCCAACAAAACAGTGGCCCTGGGTAGCAACGTGGAGTTCATGTGTAAGGTGT
ACAGTGACCCGCAGCCGCACATCCAGTGGCTAAAGCACATCGAGGTGAATGGGAGCAAGA
TTGGCCCAGACAACCTGCCTTATGTCCAGATCTTGAAGGTAATCATGGCACCAGTCTTCG
TGGGCCAGTCTACTGGGAAGGAGACCACT
gtctcgggggctcaagttcctgtgggcaggctcagttgcccccgaatgggatcattcctc
acgcttcaggcacacacactccatctcagtagggatctagccacatcccccaggactagt
aacagaggtcacaaagtggaggtgagctgggaacagagggctgcagggatgggtggtgct

Exon 13 +      47878      47971   0   Internal     94    84        Good
ccctcttcctctaacaggttttgctgcctggtggttttcgtttgttccttgttgcaaaga
agatgtcagggagcatttcttcctctagtcccccttctttctgtctccttcccttgctct
gcgtctcttagaggtctcatgtcctgtgcttgtccattttgcttccgttgtctcttctag
ACTGCTGGAGTTAATACCACCGACAAAGAGATGGAGGTGCTTCACTTAAGAAATGTCTCC
TTTGAGGACGCAGGGGAGTATACGTGCTTGGCGG
gtaactctatcggactctcccatcactctgcatggttgaccgttctggaaggtacacact
gtaacttctcctctcgatgtcctgccctcgccacgggcacggggggagcatgcatttcca
ggcttggggagacacagaggcaggagagctggaagaatgggctcctgcctgcctggtgcc

Exon 14 +      48813      48984   0   Internal    172    77        Good
tctgcgtgttgagccagggaggaaggagcctgcagcctgctcagggtggtggctggtgac
tgcggggccagggcttgctgctgtctctcggaatgtcctgcatgtgggtctggctgttcc
tgctggcactgccctcttctctctcccctcctttcccactctgccctgcttgcccgtcag
GGTCTCCGGATGCCCCTGCTGGAGGCAGAGAAGCGTTCTGTTTTTATCATCGTCCCTGTC
TTGGTCCTGTCCGTGCTCCCCATGTGCTCCCAATCAGTTGTCTTCGTTCCTCAACATCAG
GGAAAGAAAAAACAGCAACACTTCTCCCTGTCATCAGCTCTGCTGTCTCCTT
gtcaggccttgggacgttctctgggctcagtctagggtcgtgcctcatgcctcatgcctc
tctgggaaggttcccaggggcgccgcctccatggttggctggtgggttttaaaggggaag
gttgggaggaggcctgtggaaggaggagggccgtccacacccgtggggcaaagcgtgttc

Exon 15 +      50105      50280   1   Internal    176   100   Excellent
tcctagtgccacaatcccagtcctagctagaacttgccatggttcttctccctaaaagtt
cccaggggacaggagacaggtgttgcttttctaatggagcgggacctcgcatggacgggg
ccctccaagcctgctaacaccctgttcgcactgactcagccctggaagagaggccggcag
TGATGACCTCGCCCCTGTACCTGGAGATCATCATCTATTGCACAGGGGCCTTCCTCATCT
CCTGCATGGTGGGGTCGGTCATCGTCTACAAGATGAAGAGTGGTACCAAGAAGAGTGACT
TCCACAGCCAGATGGCTGTGCACAAGCTGGCCAAGAGCATCCCTCTGCGCAGACAG
gtaacagaaagtagatgggggatttgcacactcagcaccacctctctctctgggcctcta
atgccctgccctctccattgtccctaatttatagctttgggccttattttctggcttctg
ggcaaggcacagtggaatatcatgaactaagtgctctagagtctgtttcaagctagtgta

Exon 16 +      51446      51591   0   Internal    146    59    Marginal
tcagtcctagaagttgggcctcctggcctaccatggtctttggaccactctgtgttgagg
aaagaacatcagatacacagacatgtgcctctgccattgttgggaagccctgactaagaa
tgggaaggagtcaccccgtcccccctccttgctctagggtgaccccactcttccttgcag
GTGTCTGCTGACTCCAGTGCATCCATGAACTCTGGGGTTCTTCTGGTTCGGCCATCACGG
CTCTCCTCCAGTGGGACTCCCATGCTAGCAGGGGTCTCTGAGTATGAGCTTCCCGAAGAC
CCTCGCTGGGAGCTGCCTCGGGACAG
gtaataatactttgactcccaactttttgaaggcattccttgcttgctattctagtggtg
gaaggtgtgtatactaacaccttctgggcggtgaaggttcatgaaatgcctgcagaaaca
ttcattccactttctgctcgcagttgggtgaaatacagagaggtggagatggggtgcctc

Exon 17 +      51871      51949   0   Internal     79    64    Marginal
catgaaatgcctgcagaaacattcattccactttctgctcgcagttgggtgaaatacaga
gaggtggagatggggtgcctctcaaggtttgaacttcaccagccccaacttatgccactc
tctgtttcccccgaaagactggtcttaggcaaacccctgggagagggctgctttgggcag
GTGGTGTTGGCAGAGGCTATCGGGCTGGACAAGGACAAACCCAACCGTGTGACCAAAGTG
GCTGTGAAGATGTTGAAGT
gtaagtgatgcttctgtccttgcaaagaaaatcttgtcccattccaagcaaacagcaggc
ctcgggcccagcagaacagcttctctggtgcctttgctgcccacacctgctccgctgcct
gcttggggttacctgggagtggagggggtgttctgcaccttgagattgttctatgacgtc

Exon 18 +      52378      52513   0    Initial    136    89        Good
tcctcaccacatccctgcccactcactaccacctattgcaacaacggctcccatgagagg
gaagagaaaacaagtttggatgaagtggggaggagagaatcaagtcccagggaaaagcag
cccctcgacacataccccactcccttagcctttatcctgccctcctcccttcccaagtaa
ATGAGTCTCAACGTGTTCTTTAAAGCGGACGCAACAGAGAAAGACTTGTCAGACCTGATC
TCAGAAATGGAGATGATGAAGATGATCGGGAAGCATAAGAATATCATCAACCTGCTGGGG
GCCTGCACGCAGGATG
gtgggtgccggccagactggctttccctgcccagcggggagaagatctgagctggggtat
cagtcccaaggcctctctcagccacagctagggaagggggttaagagaggctgctttggc
agaggtttaaaatgtgttatctcgggatctgggctccgctcattggtgttcattcaggaa

Exon 19 +      53759      53985   1   Internal    227   100   Excellent
tgggagtaattatttctctgattttttttgggtagtagaatggatttcccaggtccccta
agaggaggcaggagatgggaggttggccggggtgtgctgctgggggtggggtttctttga
ggtgaagccaaacctgctcacctgctgctggccccatggcctcttctcctgtgcctgcag
GTCCCTTGTATGTCATCGTGGAGTATGCCTCCAAGGGCAACCTGCGGGAGTACCTGCAGG
CCCGGAGGCCCCCAGGGCTGGAATACTGCTACAACCCCAGCCACAACCCAGAGGAGCAGC
TCTCCTCCAAGGACCTGGTGTCCTGCGCCTACCAGGTGGCCCGAGGCATGGAGTATCTGG
CCTCCAAGAAGGTGTGGAACCTGAAGGCTCCCCTGGGTAATGCCAGG
gtgggaacagagcccccctagtcttccagcctgtgacttatcatcttgtggtggcgttgt
ggatgcactgagcactggccctgtgtgccctgtgtgttgtcttaggctctctgggaactg
cagagtcaggagcaccagtgtagccaggtggccttggggtcagactgatgcagggtccga

Exon 20 +      54918      55040   0   Internal    123    99   Excellent
gtgatgagaagcctggagctggcagagaatgttagaagagggaaagcaaaggttcggggg
gcagagcagtgtggcagaagttctatgagacaagtcggctagttgcatgggtggcggccg
cccagagccttccagctccctcacctccccgcctcccgctctcccttcctccttcctcag
TGCATACACCGAGACCTGGCAGCCAGGAATGTCCTGGTGACAGAGGACAATGTGATGAAG
ATAGCAGACTTTGGCCTCGCACGGGACATTCACCACATCGACTACTATAAAAAGACAACC
AAC
gtgagtgccgacaaggccgccctgtgctggtggtttcatctgagaagcaaggagtggggt
gggctgagaacccaccccccagtcccttcccacctgtgccctcatggccctgcctggggc
cactccaacctcccctgtgctgctttcagggccgactgcctgtgaagtggatggcacccg

Exon 21 +      55190      55260   0   Internal     71    79        Good
ccacatcgactactataaaaagacaaccaacgtgagtgccgacaaggccgccctgtgctg
gtggtttcatctgagaagcaaggagtggggtgggctgagaacccaccccccagtcccttc
ccacctgtgccctcatggccctgcctggggccactccaacctcccctgtgctgctttcag
GGCCGACTGCCTGTGAAGTGGATGGCACCCGAGGCATTATTTGACCGGATCTACACCCAC
CAGAGTGATGT
gtgagtttgtaatagcaattgccagggaggtgtgggatagagagcttctagcactgtaga
gtcctgctttctccctggactgaggagtcctctttctgccccagagagaaaaacaaaaca
ttgtctgtggccattccctctgctccagatgttgaaaggctgatctgttctccatgctgt

Exon 22 +      55530      55667   2   Internal    138   100   Excellent
ctctttctgccccagagagaaaaacaaaacattgtctgtggccattccctctgctccaga
tgttgaaaggctgatctgttctccatgctgtctcctggcactgccctgggtagaggattt
gtgctgggggaggggaggcggagaagctctaacaccctgtggctctccgcccatttgcag
GTGGTCTTTCGGGGTGCTCCTGTGGGAGATCTTCACTCTGGGCGGCTCCCCATACCCCGG
TGTGCCTGTGGAGGAACTTTTCAAGCTGCTGAAGGAGGGTCACCGCATGGACAAGCCCAG
TAACTGCACCAACGAGCT
gtaagcccgaggagatgtcggaggccctgagccaggccttggggcaagagtgggcttgag
gggcagggggctagactagagagtatccatctccaggagacgtccctgaccttacagtcc
tgccgcaggtacatgatgatgcgggactgctggcatgcagtgccctcacagagacccacc

Exon 23 +      55796      55901   2   Internal    106    98   Excellent
tgctgaaggagggtcaccgcatggacaagcccagtaactgcaccaacgagctgtaagccc
gaggagatgtcggaggccctgagccaggccttggggcaagagtgggcttgaggggcaggg
ggctagactagagagtatccatctccaggagacgtccctgaccttacagtcctgccgcag
GTACATGATGATGCGGGACTGCTGGCATGCAGTGCCCTCACAGAGACCCACCTTCAAGCA
GCTGGTGGAAGACCTGGACCGCATCGTGGCCTTGACCTCCAACCAG
gtaaggctgcccgtgccagagccagagctcaggccgtccccactgcgtgcacgcacctcc
ctgagcagggaggaggggcccggcccatcgctgcttcctctcgcccatcacaggagtacc
tggacctgtccatgcccctggaccagtactcccccagctttcccgacacccggagctcta

Exon 24 +      56015      56191   0   Terminal    177    79        Good
acagagacccaccttcaagcagctggtggaagacctggaccgcatcgtggccttgacctc
caaccaggtaaggctgcccgtgccagagccagagctcaggccgtccccactgcgtgcacg
cacctccctgagcagggaggaggggcccggcccatcgctgcttcctctcgcccatcacag
GAGTACCTGGACCTGTCCATGCCCCTGGACCAGTACTCCCCCAGCTTTCCCGACACCCGG
AGCTCTACGTGCTCCTCAGGGGAGGATTCCGTCTTCTCTCATGAGCCGCTGCCCGAGGAG
CCCTGCCTGCCCCGACACCCAGCCCAGCTTGCCAATGGCGGACTCAAACGCCGCTGA
ctgccacccacacgccctccccagactccaccgtcagctgtaaccctcacccacagcccc
tgctgggcccaccacctgtccgtccctgtcccctttcctgctggcaggagccggctgcct
accaggggccttcctgtgtggcctgccttcaccccactcagctcacctctccctccacct

Exon 25 +      57224      57346   2   Internal    123    60    Marginal
acctattttcagtttaggtccctcaataaaaattgctgctgcttcatttatctatgggct
gtatgaaaagggtgggaatgtccactggaaagaagggacacccacgggccctggggctag
gtctgtcccgagggcaccgcatgctcccggcgcaggttccttgtaacctcttcttcctag
GTCCTGCACCCAGACCTCACGACGCACCTCCTGCCTCTCCGCTGCTTTTGGAAAGTCAGA
AAAAGAAGATGTCTGCTTCGAGGGCAGGAACCCCATCCATGCAGTAGAGGCGCTGGGCAG
AGA
gtcaaggcccagcagccatcgaccatggatggtttcctccaaggaaaccggtggggttgg
gctggggagggggcacctacctaggaatagccacggggtagagctacagtgattaagagg
aaagcaagggcgcggttgctcacgcctgtaatcccagcactttgggacaccgaggtgggc

--------------------------------------------------------------------------------