--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (58381 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (16 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1341   2   Internal    141    69    Marginal
atcactttagtacacagtactgtgttattgtcactgtcaccaatgtcgagccaacgttta
attaatgagcagacatttaaatgttaagaactttaatctttaaaattaataaatgttcta
agtgaaaagaaacttttatgaattatatatactttttaacataatttaactttttcatag
GAGAACTATGCCATTTTTGGGTCAGGACTGGAGATCTCCTGGATGGAGTTGGATTAAGAC
AGAAGATGGCTGGAAGAGATGTGAATCTTGTAGTCAGAAACTTGAAAGAGAGAATAACCG
TTGTAACATCAGTCACAGCAT
gtaagttacagctgagcagaaccatgccatttgccagtttagcatgtatggccttaccta
tttttcaagtccctgcaaagctccataacttttgagacttgcccacccagaaggctggtg
tgaagagacaagttgtttagctaaaaaatgaggctagtagattgcctaatattcatacac

Exon  2 +       1634       1859   0    Initial    226    61    Marginal
ggctggtgtgaagagacaagttgtttagctaaaaaatgaggctagtagattgcctaatat
tcatacacagatgctttcgtctttttttttttaatttaaaacatttaatcctcacaataa
ttgggagagaggtattatttttaatcccacattatagctgaggaacctgaggaaattgaa
ATGCACAGTTTTGGTGGCATATATCAGAAATGTAGTAATAGTGGCTTACACAAGACAAAT
CAGTTTTTCTCCCTTGAAAGCCTGAGTTGGCATGATGACTTTGCTCGTAACATTGTCAAG
GGGCCAAGCACAGTCTGTCTTGTCGCTCTGCCATCCCAAGAGTGCAGCCTTACCTGCATG
GTCCAAAACGGTGTATTACCTGCTACATTTGCGCTCAGGCCGAAGG
gtaggtggggttggtgagacacgacctgtgtttcagtggcacagcccaaaagttacatgc
atcacgttgcccacaccttgttggctagagcactagcgcaagggatgctgggggttgtgg
cccagccatgtgtccagataaaaaccagagactgcatgagcacagtaccagggtaggtgg

Exon  3 +       5525       5626   1   Internal    102    64    Marginal
ttctgagtgatgtggggagtcaggggtttgagtagaagagtgatttgttcaggcctatgc
tttaacaggattattctggctaccgtgttaaaaacagacttccaagacgcaggacagaag
caagtggaccagttcttaagagggttgggttaacccccatgggaaatgatcatggcttag
AGAGAAAGGAGGCGGTGGATGAGGAAGGGCTCAAATCCTGGATGTATTCTGCAGGTGGAA
CTGACACATGGAATGTGTATGGTGCAGTAAGAGGGTCGAGGG
gtgagactaagactttggcctgagcagctagaaggtagagttgcattaactgatataaca
tctaaatccgccttgtcttgcacagggtccttgggtctgtgcctaggaacagaagcacag
tgtcacaggtcatgcgcctctttccctttccagtgaggtggtgtcaccatgttctcctaa

Exon  4 +      21014      21063   1   Internal     50    84        Good
atcttaaactgatttaagaaacaaagcaattctgtttgcattcacccacgtaaaagcatt
tcttgtcaatatagtaagtcagataattttgttaacatgtccaattatttaaattccttt
aaaatcttcattttgaaatgatttgccagattttaaaaacaaaggtaatttttattctag
GTTTTTATCGTGAAAAATGGATCTATGTCCATAAAGAAAGCACAAAGGAA
gtaagtattctattataaatatgagagtatcttgtattgtttctgttgaatatggagtca
cattaaataaatgtattaataaagttgcataaaacacatttcttttgcaatatcagatct
atggttcacattctgacagataatagcatatgaggagcttttgaggcagtgattttccat

Exon  5 +      23240      23367   0    Initial    128    86        Good
tggtgttttgggttcttggcatccgtgctcccagcctgaaagctgcccgtggtcacatcc
agcacttgccttcagccctctccatcccaatgctggttttcagaagcaccttcttgctac
cgaagcacctctcccagccctgatccttgtggttgagcatacttccagcctgggcagtgc
ATGGCTGCTCTGGAGAGAAATCCCATGTTATACTTCAAACTCGGGCAGTGCATGCCTCCC
CTGCAGAGAAATCCTGTGTTTCAACTAGATATTTGTAACACCTACATCCTTACAATGCAG
TTAATCAG
gtgatttatgtatttttagttgcgtagcctagaatgaatccagtttttttatgatcttag
ctttaacgtcgtccacaccccagtttgtccccaacaaaacaaaccggcaagatatttaat
aaatatttgtctttgtcattacttcagcaggttgtaaaaaatgtcagttaacggtgtctc

Exon  6 +      23743      23835   0   Internal     93   100   Excellent
gcttaaattattagcattgctataattttactatactctcatctaaatctaaaatcagtc
ttcaaaataaaaacaaattgtcctttgccaaaaatttttttaatcgcacaattaattgac
attaactgccaattctttttggctaattgactaattttaacttctgtgttgcttttccag
AGGCATGGCTATTGCACCTTGGGAGAAGCCTTTAATCGGTTAGACTTCTCAAGTGCAATT
CAAGATATCCGAAGGTTCAATTATGTGGTCAAA
gtaagtgttctatttcaaaaactactttgatgactcttttgaacaactatattttgaaga
ttgtaagtgtacaacgttgaagatgcttttggcagcttgaaggtgtgcctgtttgctgcg
tattaatcaaaaaacagaagggaacaagttcaggagaaaacagtgaggttggaggatttc

Exon  7 +      26755      26867   1   Terminal    113    70        Good
gtcttaggataaaagttagtagtagaatttagtgttcaattacagattcttccagttgcc
aaaataaagttaagtagtttggaatggaagtttcgtttttactctaatctttgaagttga
gtttgagccagatgtcctgttggaggcataaaatggccccaccttttgttcactgtccag
GGGCAGATGCTCTTCACTCAAGGCAGGAGGAGCCCATCAGTGCTGGCATCGCTGAGCACC
TCCTGTGTGCAGATCAACGTACCTTGGCTTTTCTAACTTTCAAGAAACTTTGA
aatccagttctagtcacactcccaccatgaaatcttctttgccagtgatcacagggttgt
ggcaataccaactcaagcctacctggctgggaccttggcctcaccgcccccatcatgtca
gcagcattccctggcccttaggtgtgccagtggccacgtgtttaagttgtctgcgtcccc

Exon  8 +      28307      28342   0   Internal     36    57    Marginal
gactactccatagtagcaacttaatagcagcagcctcacagcagcgcatgggaaagatgc
ttagtgagtgaccctgagccctcccaggcggggactcgagggtgaggcagggagggagag
aggctctgcagccacacagccgttgttggaattctgtctctttcttatttatttactcag
GGATCTCAAGCATATGACTTCATCATCACATCCATA
gtatctggtagattttagcatctacctcagagcactgttagaaagattagattagttcca
tcataggaagctcttggaacagtctgtactctgtgttagccactattttgattttctttt
gaggaggatttaggcagagggatgacagctgcatggagatccatttatgacccaagaggt

Exon  9 +      28567      28673   0    Initial    107    45    Marginal
gattagattagttccatcataggaagctcttggaacagtctgtactctgtgttagccact
attttgattttcttttgaggaggatttaggcagagggatgacagctgcatggagatccat
ttatgacccaagaggtaaagacaagaaaatggggcccagagagatgggctgaaggtcaca
ATGGAGTCAAGGACAGAGACCAAAAACGTAGCTGTCCTGACAGCCGTGAAGAGCTTTTTC
ATTACGACTTTATTTCCTAAGTCTATAAACTTTGATTTTCCTCTGAT
gtaaattaagtgactttcttaaatgcgtcatatgacttttttttaaattttttaaattat
actttaagttctggtatacatgtgctcaatgtgcaggtttgttacataggtatacacatg
ccatggtggtttgctgcacccatcaacccgtcatctacattaggtatttctcctaatgct

Exon 10 +      33526      33613   1   Internal     88    50    Marginal
tgaccgtgctaagctaatcccttgccttctgctgctgatttcagtctttttaaaaggaat
tttaaaacatgatattaaagaaatgtagaaaacttatttcgatgataggaggggaggtag
tcgggaagaccttatctcccagggaacacatattctctgttctggtatttcttcccctag
TGGAGCAGCAGTTCCAAACCCAAATGTTGTCTCAGGGGTCCTTTTCACTTTTTAAAATTA
CTGAGGACCCCAAAGAGATTTTGGTCAT
gtgagttatatctattaatgtttgccacattagaaattaaaacacttttaaaaatatttc
tccatttatttaaaagtaaggactgggctgggtgcagtggctcacgcctataatcccagc
actttgggaggccgaggtgggcggatcacctgagatcaggagtttgagaccagcctggcc

Exon 11 +      36710      36829   0   Internal    120    82        Good
ggcttcaaatttctccaaattcttcagatagtggagtaatccttacttatgggatcctcc
aggaagaaaggatggcccatgaattttatgtccagtcaaaccatcttttgtatccagtct
gcaaacaaacagtattgatcatgtgagaactcagggaatacttactgttctcatgagcag
TTTCGGCTGGAGAAACAGTGTCCATCGGACTGGATGTCAGTGAATCTCTGCAGCATCAGC
TGTGTGGCTGAGGGTGACGGAGCAGAGTGTGAGTGGAGGGCAGAGGAGAAAAGGTCGGTG

gttagaggtttgttgactgtctcacctgtaatcacagggaggcactaagatgttattcac
taaaatcaagttgtagaggagagggatggaaggaagaaggagcaagatgaatggcagttt
tatcacaatgtggaacagtaaactaacaggctaagatgtgttgtatgaggattccgaagg

Exon 12 +      38127      38211   0   Internal     85    69    Marginal
tcaggtttgcatgggtagtgactgtttcctatacttggactcggactgatacagtgactt
aatttaggatggcatgttagaaatcttcatgcatgtgtgttatatcactgtggtttgtaa
ttccatattaaatatatatatcgctcagcttttttccgtctttcctttaagctgttgcag
CTAATTGCAAAATCCCAGTTAACTTCATTGAGTGGCGTGGCACAGAAGAATTACTTCAAC
ATTTTGGATAAAATCGTTCAAAAGG
gtaagatgatcactgtatttttaatactctaaatcttaattagaaatttggtgcaaggag
atgggatttttcttttatctttacccagtacacatactgtcaaaaacaattgtgtaaata
atgtgataacatcagaaatacaggtcatccttccagttcccagtgttctgttactgccgt

Exon 13 +      39397      39587   1   Terminal    191    80        Good
tgctgaatatgtgtgagaatttccctcctttttagggctgaataatattctattgcatgt
atagatcacacgttgtttgtctgttcgtctatcagtggacatttgggttatgaaactaga
tctttttttaaagtgttgcttaactgtatcaatccatagttttatttttatttattccag
TTCTTGATGACCACCACAATCCTCGCTTAATCAAAGATCTTCTGCAAGACCTAAGCTCTA
CCCTCTGCATTCTTATTAGAGGAGTAGGGAAGTCTGTATTAGTGGGAAACATCAATATTT
GGATTTGCCGATTAGAAACTATTCTCGCCTGGCAACAACAGCTACAGGATCTTCAGATGA
CTAAGGTATAA
atatctcggcataagagttattacactctgtttttatattacagaagttatcttttctaa
gcatacatgaaagactgctatagctttttgaaagattttctaatgctttcataagtattc
attaaattgttttaaaatagaaaaggaccaaagaccccaatggcttatagttgctattgg

Exon 14 +      46497      46679   0   Internal    183   100   Excellent
tcctccagccttccccacggtggtggatgcaggccccttgacaccttgcgacgcatgaca
tggagagctctttttgtgttaccatgttttgaagcattcattccagcttgactcttcagt
tactgtgtgaacaaacattggccatcttctcagtgagttgctgttgtgttttcctttcag
CAAGTGAACAATGGCCTCACCCTCAGTGACCTTCCTCTGCACATGCTGAACAACATCCTA
TACCGGTTCTCAGACGGATGGGACATCATCACCTTAGGCCAGGTGACCCCCACGTTGTAT
ATGCTTAGTGAAGACAGACAGCTGTGGAAGAAGCTTTGTCAGTACCATTTTGCTGAAAAG
CAG
gtgagtgggatgcagcagtctcccctcaggctgggagtttatagactctgcctgggggcc
ataccctataaactcacctggagagaaagaatggctgagtattttctacttttaaagaac
caggaacaatcagagtttattgagattgctgtgggttctctcctatagaatgtaaggttt

Exon 15 +      54493      54582   0    Initial     90    41    Marginal
ctcaagatgtcaggtacttcttgccctgtcttccatctcctccgccgtgggtttgcccag
tgtggctaaccagaggcgagtggcctggtgggccaaacccagattggagtcaggcagacc
tggacctgcctccggggtctcctgagcttgctgcccctcctagggtcttggtttgacgcc
ATGACCCACCACACAGAGGAGCTGTGGATGTTCAGCAGTCCTGCACCTGGAAACTGGCAC
ATAGCTGGTGCTCAGAAAATGGCACTTAGG
gttagggtcactgcttgttctttgtttgtttagcatcccagtagtttgtgttgactgaga
aactaaagtaatatcaaagctgttaagaaaatgagactgggtgttgttgactctaaattc
tggccctgggacttggtcatgagccgacaccatggtgcatctgtctcaggtctgcatctg

Exon 16 +      56843      56932   0   Terminal     90    83        Good
tatgtagaatcggctgcggctgcccttgtgttggtcattctcatccaagttatctcccat
gtacctctgaggtggggcccagggtccacatcaacaagcagctgacgacccctcaagcac
catcactagagtgtggctggtggtggggccccctcctaaccatctcccacctccccacag
GACTCAGGACACCCCTGCACGGCGGCCGACCCTGACAGCTGCTTCACGCCTGTGTCTCCG
CAGCACTTCATCGACCTCTTCAAGTTTTAA
gggctgcccctgccatccctattggagattgtgaatcctgctgtctgtgcagggctcata
gtgagtgttctgtgaggtgggtggagactcctcggaagcccctgcttccagaaagcctgg
gaagaactgcccttctgcaaaggggggactgcatggttgcattttcatcactgaaagtca

--------------------------------------------------------------------------------