--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (100341 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (24 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1207       1225   0    Initial     19    61    Marginal
gttagttgcaacacggggcggggcgtggctttgtgcacgtcggcttccgggaagagcttt
acgatacattgaccgacattttacgacaggcgggattgttttgtggctgtcagctttccc
cgtggtctgagtttgtggctgcatttttatctctggtggctctgctacggcggcgcagaa
ATGAGGCAGAAGCGGAAAG
gtgcgaaaggggaaggagatgggggaaaggggtggtccgaaaggggcgaacgcccaggca
atcaaatgctgaaccgaacttttaccgcgagaatccgctacccagtccagtcgccccgcc
acctagggtcagtgtgtccattctggtccccgagccttctcgtttttcctgttttgcttt

Exon  2 +       5211       5310   1   Internal    100   100   Excellent
gttttaaagatacaaaagatatgatcaaattgtaaacagtagagatttagcatcttctga
acttgagctattcatttggcatatttgtatggtttcggatggaaaactgctactaaatca
gattttaaaatcttgattgaatgatacgatttttgacattgttgaatattaactttccag
GAGATCTCAGCCCTGCTGAGCTGATGATGCTGACTATAGGAGATGTTATTAAACAACTGA
TTGAAGCCCACGAGCAGGGGAAAGACATCGATCTAAATAA
gtaagtggatataaagagagagcaagcttgttcttaggtagcagatctcttttatgaaat
tatctagtactacttgttttccagctcaagttttattttagttgagaattttagctttct
gccttgccttgtcattcatttctttttttttttttgcaagttccgcctctggggttaacg

Exon  3 +       7820       8025   2   Internal    206    96   Excellent
ttcactcgtgaattttattcttctatttccctgatagtcacagatcttaaaactatcctt
gtcacgtggtgaagggattggagagtgacagttgttaatgatgttgtttatagatcatcc
tcttggtagcttgtccttaaataaccgtaatcttgataatgtgagatgctttactttcag
GGTGAAAACCAAGACAGCTGCCAAATATGGCCTTTCTGCCCAGCCCCGCCTGGTGGATAT
CATTGCTGCCGTCCCTCCTCAGTATCGCAAGGTCTTGATGCCCAAGTTAAAGGCGAAACC
CATCAGAACTGCTAGTGGGGTGAGTGATTCGACTCATGAGGTATCGACACACTGGGTATC
TGTTCTGGCAGAAGTCCCTGCTCCAT
gtgacgcccgtgtagtgaggtagaggttggggattctgaactaatgaagtccctgtatta
ggatatgtgctggagtggagacctgtgctgaatgcaaggagagcagagagagaaaaaaat
ataattgtgattaaaggagtagatgatgttttgacctctttaaaaatatagatttaggct

Exon  4 +      15905      16023   1   Terminal    119    71        Good
tatttacttcttggtagaaaatacattatttacagatactgcaaaggtagattcttctgt
taggatttgaaaaggaagctcatttgttatcaggattctttggagatggtagatgcttgg
aactagctgattgaactcagttttgcatctgacattcttgttcttttgttgtactggcag
ATACTGCCCTGGTGGACCTGATTCTGATTTTGAGTATTCCACCCAGTCTTACACTGGCTA
TGAGGTACAGTAACTTTGAGGCTGTCCTGATGAAATGTTGCATCATGCTTTACCTGTAG
tatggttttaccagtactggctttctgacaattttttgtttttgtttttgtttttttctg
attttaaaagctgttcattcaccaaatatttgccagtgtctactagtgccctatattatt
ctagccactagagaaatacttacataagcataaataatacttacttcttatcccaaatgc

Exon  5 +      21031      21165   2   Internal    135    94   Excellent
gggcctattttttatccacagaattagctaagtgtgtttcattacttctgatttttaaac
tgtactgatgaaaacactgcaaaataagagatttgcaatgccttcttagagtagttcctt
atgcttatatcattctaatgctgatgaatttgtctttcagttaaaacaacttggtcatag
TGTGGATAAAGTGGAGTTTATTGTGATGGGTGGAACGTTTATGGCCCTTCCAGAAGAATA
CAGAGATTATTTTATTCGAAATTTACATGATGCCTTATCAGGACATACTTCCAACAATAT
TTACGAGGCAGTCAA
gtaagaaattcttattttatcatagtctccagagtggttgtcagtttatgctcctagcag
tagtctacgagaatgccttctgccctgcatccacattcttacttctcataatctttcttg
tttcatgggaaaggattatttcagtgaaaataatgctttcgctgaaataatcttttccag

Exon  6 +      22441      22579   2   Internal    139    77        Good
ggggtgttctagggacagagaggaagccagcatggttagatcctgtgttaatccatttgt
gtccctataaaggaacacctaagactaggtaagttataaagaaaagaggtttaattggtt
ccagttctacaggcttcacatgaagcatagtgctggcatttgcttctggtgaggcctcag
GAAGCTTCCAATCATGGTGGAAGGTGAAGGGGAGCCAGTACATCACATGACGGGTGCAGG
GAGGTGCCACACTCTTTTAAACAACAAATCTCACGTGAAACAACTGAGCGAGAACTCACT
TATCACCAAGGAGATGGTG
gtaagccatttatttatgaggaatccagccccaggacccaaacacctcccaccaggccac
acctccaatattggggatcacatttcaacataagatgtggaggggacaaacacccaaacc
atgtcagatcccagtgaacaagagaaagaacgtcatgagacggggttgaagtgttaggta

Exon  7 +      22890      22999   1   Internal    110    59    Marginal
ccagtgaacaagagaaagaacgtcatgagacggggttgaagtgttaggtaagggccaaga
tacatgcttttaaggagttgaaattttatttgaaatgcagtagggagcagatgaagggga
agtggcaagttctggttaacaggtagggtcattccggctactgtctggctaatggattag
AGGAGTACCAGGGTGAAAGTGGGAAACCAGATAGGAGGCCATCTGATTACATCCATCCCT
GCTCAGATGGGGGCGGCAGCAGTGGTGATGGAGAGGAGATTGAGATGGGG
gtaagagaaaagaagggatcaagcctgacactaaggttttggctgtcagaaatggtagga
aggtagggtagggctgtatactgaggtgggaaagatagcgggaagagcagagaaaatctc
agagggagaaaatcaagagttctgttttggatgtgtgaagtctgaagagcctgtgataca

Exon  8 +      33080      33185   2   Internal    106    54    Marginal
tcatgatataaccaccaatatcgaggaagcagacttgactaccatctcaaaaaaagattg
ggggtaatagttatttttaaatcctcaagcacatcaaacatccaactcagttaagtctag
agcatcactagcagagcattgggcagaacttcaaattttattgaggtattttcaagatag
GGTAATAGTTAAGAAGAGGAATTTGTTCATGGTGCTGCTGCCAAGGAGTTACACCAATAA
CTCAAGGTGTTATCAACAATTCAAACAAATCTGGCTGTTCAAAGAA
gtgagtaaactccactgacttgttttgggaccgtagatggagaagagattgtatgttgtg
actaacgaaaatgaatatttcatctctgtaccattttttactgtgcaatttggtttgaac
aggttgagtatgaggttgcagcatgtccacacagggaatgttctgtaagccattcagcaa

Exon  9 +      36039      36076   1   Terminal     38    47    Marginal
gagttcaaatgtccagaatgaaagatttgagaatttgttctctagattggtgattcttag
ctttcttaattattattggcaataaataagtccgtttttattgacaattaagagtgaaag
agtgaacctcatggaattagttacaaaaattacagaaattttatgatttttacttttcag
TAAAGAACAATGAACTTCTTCAGAAAGAAGGAAAATAA
atgggaaattttttttaaaggcttctctcatcctccccccaaaattgagaacattgtaga
agggtgcactaagaagaatgatggggttctaagaattgagagatgttggccgggcgcagt
ggctcatgcccgtaatcccagcactttggggggccgaagcaggtggatcatttgaggtca

Exon 10 +      37558      37655   0    Initial     98    94   Excellent
agcctacactctttaccactatctcatactaggaggacagagagaaggcagttttttgag
acagagtaatgtcttaaaacctgcaacaggttaattattttagatttgctctacaggtat
tctgagagaagcctcacaaagtgtattggaattactattgaaaccagaccagattactgc
ATGAAGCGACATTTAAGTGACATGTTGACCTATGGCTGCACAAGGCTGGAGATTGGGGTG
CAGAGTGTTTATGAAGATGTGGCTAGAGACACCAACAG
gtaagatggtggcaggtgatcttgcacaagtcttcctccaagttcaccattttctctaca
ttcatacccagcctttcttccttctgaccactcttagggaaagaagtatgggtattcctc
cttttcagagttctttcttctgtctgtgttcttaattccatcccctctttccctcatttt

Exon 11 +      38018      38123   0    Initial    106    57    Marginal
gtctttctctagtgggtcttttccagcagcctgtaaacacactcatctctctccctcttc
ttgtcctaagcagccttgtccatatagagagcaggggagaggactcggggttagtagttt
aaagcaggagagaaggccaagaacaaagaaaagagtttgaataaaaaggacatcagggta
ATGTTTAAGAGATTCATTTTTGTGGAGCAAATACCAACTAGCAAAAAGTTTGGTGATGCC
ATGGTTGTAAACTTTGAGAAATTTGGGAGTGCAAGAAAAGAAGGAA
gtaagagttgttagagctttattatgttccctctagaagtatatcttttagttgaaaaga
aaatacccgcgaaaggttaactgtataaggaacttcacagttaattgctaaattagtgga
gtaggggagacaattgagagtttattaggcagctgagatgattgaccgagaattctaacg

Exon 12 +      40270      40396   2   Internal    127   100   Excellent
atgactttctgagatgtcttttcccccagccatatgattttggttatggaacttctgtta
cctgtctcagagattgttttccccttgttccttgtgttaactttgtcacccatttatttg
tgtaacagatgttacacaaataggtagtgattttcacaggtagtgattttctttccttag
GGGCCACACTGTGAAGGCAGTGTGTGAGTCATTTCACCTGGCCAAAGATTCCGGTTTTAA
AGTGGTGGCCCATATGATGCCTGACCTGCCAAACGTGGGACTAGAAAGAGACATTGAACA
GTTCACA
gtaagtgtgacttcagccaggcgcattcagaatggctctgcatgtttcttatcccatctg
gtcttgttgcttgttcactgttgatgttttccagtgttaaagaaatgcatccttattata
gaatattagaaacacagtagggtaagagacatcacccatagccccatcagacaaaactct

Exon 13 +      45690      45887   0   Terminal    198    76        Good
ccccagtgagactacagaaacaaggagtttctgttctgtctgtacgccctacctggtcag
aagcaaaggctgccccagggcctactgggtgtgccagagaagctgtcaggggttgagatt
tcaccctcggtgatctctgcataactaatggagaagtcattttctgttctctattcacag
GAGTTTTTTGAGAACCCTGCTTTTCGTCCCGATGGGCTGAAACTCTATCCTACCCTGGTG
ATTCGTGGGACCGGGCTTTATGAGCTTTGGAAATCAGGAAGATATAAGAGTTACTCTCCT
AGTGACCTGGTTGAATTGGTGGCTCGGATCCTAGCCCTCGTGCCTCCATGGACTCGAGTG
TACCGAGTACAGAGGTAG
tgtgttatcttttattcctaaaatagttggtgactagtctgtttactatttctcatggaa
atagtctgatttcatattgagggttttggatttttcttaatggaaataagataactggaa
tgctatctgtaaatagggagggatggaaatcatagcatgtctaagccactttgccaataa

Exon 14 +      64936      65064   0    Initial    129    75        Good
atttgggccacactttgaaagacatggttccaaggattgcatatggtgtttgtggactta
acctaagacattttattctctcactcaaattattagggagaaaatgtttcagaagattgt
tcaggggagagtttgtgaatattattggcatattctaccaaaaaaaaagtgaacaatttt
ATGTTCCAGAAAAATAGCAAAGGACACCAAACAAGATTGTGTGCCTGCTTTGCCTCCAAG
GCTCCAGCTGTTTGTGTTCTCCATCTCCTCTCGCCTCCAAGAAGGCCACTGACCTTCAAG
AAGGCCAAG
gtgactgacctggcctggttatcccaacaatctcgttatccatccatcttctttaaccct
cacccctcataagccttgttagcctctattaaagtaagctgggattgagtccaaaggctg
gaattcagtcatagccaaaatatatctagttcctataggcaacatcttgagcagaaaata

Exon 15 +      65842      65929   0    Initial     88    75        Good
actggaagaaaatgtttatggtttgttctatgggggggaaatataccataagatatataa
ttgaataattacaatgatttataataatgaaaaggattgtgtaattgtaaatgtctggta
gcatagcatgcactgtgggttgtggaatagaagtgagagccacatcacagatgcttggcc
ATGCAGACCAGACATTGCATTGGCATTGTCTGCAGGCAGCTCCATGCCTTCTCAGATATT
CAAGAGCCATTTGTGATTGTGCTTCAAA
gtatgtaatacatagctctaggttcctcctccctccctccctctcttccttccttccttc
tttccttccttccttccttcctcctttcctttcttccacagtgcccttcttgcaaaaaaa
aaaaaaaaaaaaagccatcttcaacatgtaatttttggatattcctaaaatgatacaaat

Exon 16 +      66560      66625   0   Internal     66   100   Excellent
aaggtggttttattttgaaattcagctcttttatctcactgcaagttatatgcaaactta
attttgagcccagggtttggtggagaggtttaaataaaaataaagattgaattggttacc
agttttatatttgtacccctcccaccccccaaccccgctcacgccatttttttttgacag
TGTCGAGATGTGAGAACCAGAGAAGTTGGAATCCAAGAAATTCATCACAAAGTACGGCCA
TACCAG
gttagtctcttcatgtcatagagggcctaggtactgtccttagatctttgccaaccctgg
gcccacatattcttaaccaaggacagagccccaggagtgaataactaagagcagagacta
atcgaggattagataccggtgtcaaaccgtgaaagccaaatacaagaattctagaagagc

Exon 17 +      68221      68412   0   Internal    192    84        Good
caaggtgtgaactttaatcttggtgctatttgagagtagacaagtaaaaagaaacataat
tagtgattattcattccttatccctaactagatattaacctaaataaatacatacaatta
caaaaatgaatttggttctttaattttgaataatattttttgtggctttttactaaatag
GTTGAATTGGTAAGGAGAGATTATGTTGCAAATGGTGGCTGGGAAACATTCTTGTCATAC
GAAGACCCAGATCAAGACATTTTGATTGGCCTCCTACGATTACGCAAGTGTTCAGAAGAA
ACTTTCCGTTTCGAATTGGGTGGAGGTGTCTCCATAGTACGAGAGCTGCATGTGTATGGG
AGTGTGGTCCCT
gtgagcagccgggatcctactaaatttcagcatcaggtatcctgtattccatttctattt
gacttctaagaaactgcctaagtaggaaaagagaaaaggaatggggtgaagagaagagga
agaggcagaggagcaggagaggggaaagagaagcatagaaacagaggagccagtgtttta

Exon 18 +      69989      70070   0   Internal     82    82        Good
tgctacagtgtacctttggtaggattgaatggtttctttttccttactcccataagtggg
ctttttcactcttaacagattttagcaactactaaagtatatagccttcttgttttatgg
acccctcttaatgaacttccttcctttttaattcccactccccattgttgctccgtgcag
GGATTTGGCATGCTGCTGATGGAGGAAGCAGAAAGAATAGCTAGAGAAGAACATGGGTCT
GGGAAAATCGCTGTGATATCAG
gtaactgggggagggcgaagttcatgattccttcccattttgaacttggcaccacagtga
aaactatgttggtaccctcttgcccctgttgatggttattacgttcaaaattgagctgag
ctgactggcgaaggacttgtgctcaaacaaaattcacaaaagcagtttagtggaatagag

Exon 19 +      75910      75978   0   Terminal     69    92   Excellent
aatgtcccctaattaaatgtacattttctgggttctgtatattcctctgttccattttgg
tattctaataaagatcatatatgtttcttttttggtgcatgttccagtagtatttttaaa
atcattattaatatcttcttaaagacaatggatacaatataaagtatttctttactacag
GAATTCAATTTCAACATCATTATTAATCAGACTGGAATTGATGATATGGAATACTACTTT
GCTAGATAA
tgtattagctaggtgtttgcttattggtgtctgttgtagctgcactgtggcagcattgtt
ttgtagctcctcccaggaatctgtattccatgacttgacatttactcatttgaaggtgaa
tcaggtaccagtttgtagtacaccgcacatcaagtgcattagaccatctctaacttggca

Exon 20 +      80715      80845   0   Internal    131    61    Marginal
tgtgtgtggattctttagcattgcctacatataaggtcatgtcatcttgaatagagatag
ttttacttattcctatccaatttgggtgcctttcatttcttattcttgcctaattcctct
ggctagaacctttaagtactgtggtgaaaatgggcaaccttatctggcttctgatcttag
GGGGAGAGGTTTCTGTTTTTCACAATTGAGCATGATATTATTATCTGTGAGTTTTTCACA
TATGGCCTTTACAATGTTAAGGAAGTTCCCTTCTATGCTAATGTATTGGGTGTTTTTATC
ATGAATGGGTT
gtgagttttgtcaaatgctttttctgcatttgagctgattgtatgattttttttcccact
taattctgttttggtttattacattgatttttgtgtgttgaactatccttgcattccagg
gataaatcccacttggttgtggtatataatccttttaatatgctggtaaattcagtttgc

Exon 21 +      89515      89575   0    Initial     61    84        Good
ttttagaaatggtgactgcaatttatcaagttgttactgaaaagtatcccccttcccatt
ctcacatttgtaagctgaatctgtttacaaagtttattattgcctgttatcagacccttt
tctgtgatttattcttcagtttcttactaagccatattgttaacaatggaaatagccacc
ATGTTTGTTTCATCTAATGAGTTATCAAAGGACATTGAAAAACTGGACACAGATACAGGA
G
gtgaggtgatcaagacaaatggcaagttctttctttaccagaaaagaagggatgtgcttt
cccacgaagactagaggtgcaagaccagagtcaggggagttgagtgggcctaccccatca
cataggtgccaggcgcattagaaacgctctgggccatggggtcaggcaggctgggtctca

Exon 22 +      92268      92383   1   Internal    116    94   Excellent
ggtggctaagtgcaggggtaatgcctttcccaacctgttctgcaggttgtagaaacagga
ggaaatttttctttcaaaaaacaagaggcagaaagaaatttagctctttaggtgagcaga
ggttagagtccagactgactagaggtgaagttcccttccctggatgccagcacttctcag
AGGACCTGGAGACAGTGTTCCATCTCAGGGCTGAGCTCGCCATCTCAGGCCTGCTGCGTC
TTATTGAAAATAAGGACAAGAACTTCAATATACAGCTTTCCTCCAAAAGGCCCATC
gtgaggcctgagtgcccctgcccaaggtggtaatcgtttctagggcacaccccctgtaga
aaggaaaaagtagaaggcccaaggagcctgtagctccgtgggaatcatgatgagaaatgc
ttagatgtaccccagtaaagcagctcttttaaccagcatgcttaagaaatcagggcactc

Exon 23 +      97641      97717   1   Terminal     77    59    Marginal
ctatattttaatgcagcctgaattcaaagtaataatgttccaaacttattaagctgagat
tttatgtgggagagaatttggtctctgggtgggagagagtgtaaggctgagggaagcaca
tgccgacttttgagaattgctaaagtgaatgctccttttttaacttcgatttttctgcag
GGGTCGGCACCAGGAATTATTATAGAAAGATCGGCTACAGATTACAAGGCCCGTACATGG
TGAAGATGCTGAAATAA
tggccacaccagtccactcttctgcagtatcctccctggcagaacacggagaatcaggat
ttcttaaatactcaacagagaggctgagcagagcaaatggggggcttcaccctcatcccg
cagctgcagagactggaaactgccttcaaggccacggctggtcatctgctgaccacaccc

Exon 24 +      97814      97954   0     Single    141    50    Marginal
tctgcaggggtcggcaccaggaattattatagaaagatcggctacagattacaaggcccg
tacatggtgaagatgctgaaataatggccacaccagtccactcttctgcagtatcctccc
tggcagaacacggagaatcaggatttcttaaatactcaacagagaggctgagcagagcaa
ATGGGGGGCTTCACCCTCATCCCGCAGCTGCAGAGACTGGAAACTGCCTTCAAGGCCACG
GCTGGTCATCTGCTGACCACACCCCAGATCCGCCCTCTCCTGCGTGCACCCCAAAAAATC
ACTTGCGTTTTTGAGGCTTAA
atcatctatccagtttctacattttgcatgaggcctgcaggtggcctattttgactcaga
cggtgaaaaaagcaaattaactcatttggacaccataactcatgcaataaaactgattgt
cattcgaggagcaaacttaagagtagtttatttatataccctggggacagaaagtcaggt

--------------------------------------------------------------------------------