--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (6690 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (6 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +       1201       1269   0    Initial     69    69    Marginal
actcagaagaaaccgcagggcctatcagcctgtcgtcatcgagcagactagaatagtata
gaaaaccctaggcagagaggaaatgaacttcagagaagggaaacacacggctaagaagag
agaggcaagggcaggagtgaaggagagagctgaagcctggggctccgagatggtcagagg
ATGGGAGACGGGGCAGTGAAACAAGGCTTCTTGTATCTTCAGCAGCAGCAGACGTTTGGA
AAGGTAGGA
gtgaggctgggctggggttgggcagggggcctgggaggctgctagaattcctgggttgga
gagggagtttcatattcaaaacccttataggtctgactgtgcacccaccaagttagaccc
agagctcaactttgggagggctcttttcctacccgacgctgtctcctgaaccaggcccca

Exon  2 +       2292       2573   0   Internal    282    88        Good
cctgcagtcactgtcctcttctctgcctccctgggtctcatgtgatcttcacctctctct
ccccatctccaagtggctgccccagtccccctcccacggttcctcttctccccttggctc
acgatctccccgtctctgggtggctccctcccgcccccgcctcccacgcctctggcacag
AAATGGCGCCGCTTCGGCGCCTCACTGTATGGAGGGTCGGACTGCGCCTTGGCCCGGCTG
GAGCTGCAGGAGGGCCCGGAGAAGCCTCGTCGGTGTGAGGCTGCCCGGAAGGTCATCCGC
CTCAGTGACTGCCTGCGGGTGGCCGAGGCCGGCGGAGAGGCCAGCAGCCCCCGGGACACC
AGTGCCTTCTTCCTGGAGACCAAGGAGCGCCTGTACCTCCTGGCGGCCCCTGCAGCGGAG
CGCGGCGACTGGGTGCAGGCCATCTGCCTCCTGGCCTTCCCC
gtgagtcgcgcggggtgcggaaagggcaagggggcgtgcaggccgagggtgttagatact
tcctgtgggcaagtgttacaggtgtcaaggtcagggtgatggggtgcttcctccatgtgg
ggggacccgaacccagtgtgcagacagagccagcaggttgaggtggcctgaaagaaggcc

Exon  3 +       2814       2901   0   Internal     88    52    Marginal
tcctgtgggcaagtgttacaggtgtcaaggtcagggtgatggggtgcttcctccatgtgg
ggggacccgaacccagtgtgcagacagagccagcaggttgaggtggcctgaaagaaggcc
tgggccagaggggggcctggggatcggggaaggtgatgagacggggcgcctcctccctag
GGGCAGAGGAAGGAGCTCTCGGGGCCAGAGGGAAAGCAGAGCCGGCCCTGCATGGAGGAA
AATGAATTGTACAGCAGCGCAGTCACAG
gtgagggggcgggggctgccctgctctcccctgggggctctccccagggtgaggtggaga
ggaggtgtgggctggctagctgctggccccgagtcttcctgccttgtggttatccccagc
ctgggccagccccgttatcagcctctccttctcgcttccgggtgcagcccaacgtaggga

Exon  4 +       3945       4129   1   Internal    185    89        Good
ttggggagtatgacctggcacagagcagctcagcctccaagacccaggcagggggccata
agtgtgtggataatactttctagaaaagttctggtacgctcatttagaactgggcagtgg
tgaggcaggccagctgtttcccattaactgccttcgccttctctctcttcttctccccag
TCGGCCCCCACAAGGAATTTGCTGTGACCATGAGACCTACAGAAGCCAGTGAGAGGTGCC
ACCTGCGGGGGTCCTATACCCTCCGGGCTGGGGAGAGTGCCCTGGAGCTGTGGGGTGGGC
CCGAGCCAGGGACCCAGCTGTACGACTGGCCCTACAGGTTTCTGCGGCGCTTTGGGCGGG
ACAAG
gtgagtgggaagctgcatcagggcaggttgagagaaaggataagctacgaacaaagaggg
gtgagaagcagcgaggggatgggagagaccaggagagggagatggagtgaagcaaagaat
agagtgacaagatggcagaagtggagtagaaggaaggagaatgagaagaggtggagagac

Exon  5 +       4871       5313   0   Internal    443    84        Good
taccagggaggctgaggcaggagaatcgcttgaacctgggaggcggaggttgcagtgagc
tgagattgtgccactgcactccagcctggagacacagtgagactctgtctccaaaaaaaa
aaaaaaaaatgcacccctgccctgtggcctggccaataacctgctttctccctggtccag
GTAACCTTTTCCTTTGAGGCAGGCCGTCGCTGCGTCTCTGGAGAGGGCAACTTTGAGTTC
GAAACCCGGCAAGGCAATGAGATCTTCTTGGCCCTGGAAGAGGCCATCTCTGCCCAGAAG
AATGCTGCACCCGCTACACCCCAACCGCAGCCAGCCACAATCCCCGCGTCGCTGCCCCGG
CCTGATAGCCCCTACTCTCGGCCGCATGACTCACTGCCGCCGCCTTCACCCACCACACCG
GTGCCTGCTCCACGGCCTCGGGGCCAGGAGGGGGAGTATGCCGTGCCCTTCGATGCGGTG
GCCCGTTCCTTGGGGAAGAACTTCAGGGGCATCTTGGCAGTCCCTCCTCAGCTCCTGGCC
GACCCTCTGTACGACAGCATTGAGGAGACCCTGCCCCCTCGACCTGACCACATATACGAT
GAGCCCGAGGGAGTGGCTGCCCT
gtccctctatgacagcccgcaggagccccggggtgaggcatggaggaggcaggcgacagc
tgacagggaccctgctggcctccagcatgtccagccagccgggcaggatttctctgcttc
tggctggcagccaggaactgagtatgacaatgttgtactaaagaaaggcccaaagtgaca

Exon  6 +       5138       5345   0   Internal    208    90   Excellent
ttggccctggaagaggccatctctgcccagaagaatgctgcacccgctacaccccaaccg
cagccagccacaatccccgcgtcgctgccccggcctgatagcccctactctcggccgcat
gactcactgccgccgccttcacccaccacaccggtgcctgctccacggcctcggggccag
GAGGGGGAGTATGCCGTGCCCTTCGATGCGGTGGCCCGTTCCTTGGGGAAGAACTTCAGG
GGCATCTTGGCAGTCCCTCCTCAGCTCCTGGCCGACCCTCTGTACGACAGCATTGAGGAG
ACCCTGCCCCCTCGACCTGACCACATATACGATGAGCCCGAGGGAGTGGCTGCCCTGTCC
CTCTATGACAGCCCGCAGGAGCCCCGGG
gtgaggcatggaggaggcaggcgacagctgacagggaccctgctggcctccagcatgtcc
agccagccgggcaggatttctctgcttctggctggcagccaggaactgagtatgacaatg
ttgtactaaagaaaggcccaaagtgacagaggcagcagagggatggtccaccgccccttg

--------------------------------------------------------------------------------