--------------------------------------------------------------------------------
GrailEXP v3.31 [March, 2002]                   http://compbio.ornl.gov/grailexp/

Authors:  Doug Hyatt, Manesh Shah, Victor Olman, Richard Mural, Ying Xu, and 
  Edward C. Uberbacher, 1996-2001

Reference:  "Automated Gene Identification in Large-Scale Genomic Sequences",
  Xu, Y. and Uberbacher, E.C., Journal of Computational Biology, Volume 4,
  Number 3, 1997

Sequence:  >GrailEXP Input Sequence (9684 bp)
--------------------------------------------------------------------------------
PERCEVAL Exon Candidates (10 predicted)

 Index Std   Begin       End     Frm    Type     Len    Scr    Quality

Exon  1 +        644        769   0   Internal    126    69    Marginal
aacattttggaaaaggccaaagcatggtgatgataaaaagatcggagatgtcagggactg
gggcaggagggatgagcaggcagagcacaggttttcttttcctctttttaagacagtgaa
aatactcctaggatcctgcaaggagggatacaaattacatacatttgtcaaaacccacag
CATGTTGACCACCAGGAGGAGACCCCATGTGACTCCAGGACCCTGGTTGATAACAACGTA
TCGAGATTCCTCACATGGAACCAGTGCGCTCCTGTGGTGGAGGGTGTACCTGTGTCAGGG
CAGGGG
gtacgtggacattttctgcagtttttgatcaattttgcaatgaactaaatctgtggtata
aaaataaagtctattaaaagaatccaaggctccctctcatctcacgataagataaagtcc
ccatccattttactcctctcagccctggagaaaggagaggccaggtcccaccaccttcca

Exon  2 +       1324       1442   0    Initial    119    77        Good
gagcaggttcctgggtgagataaaaggatttgggctgaacagggtggagggagcattgga
atggcactcagggcaaaggcagaggtgtgcgtggcagcgccctggctgtccctgcaaagg
gcacgggcactgggcactagagccgctcgggcccctaggacggtgctgccgtttgaagcc
ATGCCCCAGCATCCAGGCAACAGGTGGCTGAGGCTGCTGCAGATCTGGAGGGAGCAGGGT
TATGAGCACCTGCACCTGGAGATGCACCAGACCTTCCAGGAGCTGGGGCCCATTTTCAG
gtaaagccctccctggccctcgctgggaacacccagatccctgcccctgctgcccaggac
cctgccaggcactcagcactgccattcccagcaggtcccggcactctgcatcctttggag
gatggggaaggagtgcagcacatgctggtctgtggtgctgccagggcaggggatagtgca

Exon  3 +       1830       1985   2   Internal    156    86        Good
ggcaggactcagaagcactaaagttgaaaggttccagggagccagcaggagggctttagc
tgtgaagccgctaatccaggagcagggagggtggacaggagacactttggattgggactg
cagggtggggccacgagggacatgaccccgtccagcagggcctcctgcttggccccacag
GTACAACTTGGGAGGACCACGCATGGTGTGTGTGATGCTGCCGGAGGATGTGGAGAAGCT
GCAACAGGTGGACAGCCTGCATCCCTGCAGGATGATCCTGGAGCCCTGGGTGGCCTACAG
ACAACATCGTGGGCACAAATGTGGCGTGTTCTTGTT
gtaagcggcgagttgggagctgagagctgggagcagggtgggcagcctgggtgtaggggg
gaggcgagagaggtaggacccaaaagcacatctgccctgggcccctgtggtgggcagtga
gggtgagcacccggcccagaggacggccatcctgtggggtcgcgtctgcactgtgggttg

Exon  4 +       3799       3998   2   Internal    200   100   Excellent
cagcacctggaggccgctctgagaaaaggctgcagctcgaacacaaacaggcagcttcta
ccagggcccccagtcagctccctgcaggccgattccccttggggacaaggaggatgggat
acgggtcagggcctgtgtcttgctggggcggcctcacaagctctgccctggcctctgtag
GAATGGGCCTGAATGGCGCTTCAACCGATTGCGGCTGAACCCAGATGTGCTGTCGCCCAA
GGCCGTGCAGAGGTTCCTCCCGATGGTGGATGCAGTGGCCAGGGACTTCTCCCAGGCCCT
GAAGAAGAAGGTGCTGCAGAACGCCCGGGGGAGCCTGACCCTGGACGTCCAGCCCAGCAT
CTTCCACTACACCATAGAAG
gtgtgggccatgcgggaaggtccagccccagagaccctggagtggccagggatggggatg
gaggactgaagggagtgtggggaggcagccaggaggcctggggctgccttgtgctcagca
gtgcatcctccccgcagccagcaacttagctctttttggagagcggctgggcctggttgg

Exon  5 +       4228       4339   0    Initial    112    63    Marginal
ggatggggatggaggactgaagggagtgtggggaggcagccaggaggcctggggctgcct
tgtgctcagcagtgcatcctccccgcagccagcaacttagctctttttggagagcggctg
ggcctggttggccacagccccagttctgccagcctgaacttcctccatgccctggaggtc
ATGTTCAAATCCACCGTCCAGCTCATGTTCATGCCCAGGAGCCTGTCTCGCTGGATCAGC
CCCAAGGTGTGGAAGGAGCACTTTGAGGCCTGGGACTGCATCTTCCAGTACG
gtgaggccagggacccgggcagtgctatggggaagggacaccatgggggcccaatttctc
cttctccaccacccagtggggaatggaggccacagggaggggtcggggattcctcacctt
cctgccggggagattggtgcgaggctggggctgggctgggctgatccggagaatttggga

Exon  6 +       4626       4780   1   Internal    155   100   Excellent
ggattcctcaccttcctgccggggagattggtgcgaggctggggctgggctgggctgatc
cggagaatttgggatgagagcagggagatttgggtgtcggggcagtctgggcaggaggag
gacactgaaggatgcttcccagcaccaagatctgagggctgtcccctgctccctggacag
GTGACAACTGTATCCAGAAAATCTACCAGGAACTGGCCTTCAACCGCCCTCAACACTACA
CAGGCATCGTGGCGGAGCTCCTGTTGAAGGCGGAACTGTCACTAGAAGCCATCAAGGCCA
ACTCTATGGAACTCACTGCAGGGAGCGTGGACACG
gtcaggccagcaaccagccccacccagagagggtgatgccaagcctgcctcccaggcact
gcctgccaatgccacacggcacccacgttccccatccccaggctacaggccccacatttc
tgttgccctcagccttccccctcctttgttaagggatgagatttgcaggggaggggaaat

Exon  7 +       5593       5759   0   Internal    167    93   Excellent
aagaagtcagggaatctggcccaagtggtcatcaaggtttcagatccggggtcccagggc
tctgtttttgctcagggcatggatgtctccacccctcagagggaggttgtcctgggaggg
gtgtcccgggggctgagtcctcctgtgcaaggtctgaccctgcagacatggcttctgtag
ACAGCGTTTCCCTTGCTGATGACGCTCTTTGAGCTGGCTCGGAACCCCGACGTGCAGCAG
ATCCTGCGCCAGGAGAGCCTGGCCGCCGCAGCCAGCATCAGTGAACATCCCCAGAAGGCA
ACCACCGAGCTGCCCTTGCTGCGGGCGGCCCTCAAGGAGACCTTGCG
gtgggtgctggctgaggcctccctgtggccctggccccctgctggagagcagcccccact
gggtggtggcagacagaatctggggctgataaacagcgtcacccagcagcccattcccct
gcacctgctcttcctccccctcaaggacagggagctcttcttcctctggaatccctcttc

Exon  8 +       6159       6237   2   Internal     79    70        Good
ttggggcttctcaagttaggggaggtttggctgggctcagcaggtgcaaggaagtacttc
ctacgacctgggcttcccatggatctgggacctctgcggggtcttcggtaggaagggtgc
agagagcacaggaagccccatccagctgaggaccctttctatggatgcccccacctccag
GCTCTACCCTGTGGGTCTGTTTTTGGAGCGAGTGGTGAGCTCAGACTTGGTGCTTCAGAA
CTACCACATCCCAGCTGGG
gtgagtgagccccacacccctcgagctgagaacctccctccccagtcattccctgatccc
tgctctgcaccgtccgcagacattggtacaggttttcctctactcgctgggtcgcaatgc
cgccttgttcccgaggcctgagcggtataatccccagcgctggctagacatcaggggctc

Exon  9 +       6317       6514   0   Internal    198    84        Good
ctatggatgcccccacctccaggctctaccctgtgggtctgtttttggagcgagtggtga
gctcagacttggtgcttcagaactaccacatcccagctggggtgagtgagccccacaccc
ctcgagctgagaacctccctccccagtcattccctgatccctgctctgcaccgtccgcag
ACATTGGTACAGGTTTTCCTCTACTCGCTGGGTCGCAATGCCGCCTTGTTCCCGAGGCCT
GAGCGGTATAATCCCCAGCGCTGGCTAGACATCAGGGGCTCCGGCAGGAACTTCCACCAC
GTGCCCTTTGGCTTTGGCATGCGCCAGTGCCTCGGGCGGCGCCTGGCAGAGGCAGAGATG
CTGCTGCTGCTGCACCAC
gtaagcaggcctgggggcgggggcgggacctgggcagcagaggcgggacctgcacactgg
gggcggggcttgcatggtgtgattgacacctgggaacagtggatggggccttggttggtt
gaggtcggcgtgaccagggaggatctgtgctgagcaagacagggtaggatctgggtgagg

Exon 10 +       9201       9263   0    Initial     63    69    Marginal
gagtcacagggattgtctctggctgtctggtgcctgactctgggggaatctgttcagggg
agctgtggcctggagtgtgcaacaaggtggctggcaagacttcacaggaaaggcattcac
caggggggaccttgaccatctgtagtaactggccagccctggtagggcatcctgtccagg
ATGCAAGCCCAGAAAAGCATCAGAAGCACAGAAAATAACAAGGATGATTACATGATTGGC
CTG
gtgatgcttggatgtcattattgagaaagcactagcattagtttctttatccacttgttg
attgatgggtgtttgggttggttccacgtttttgcacttgcaaactgtgttgctataaac
atgcgtgtgcaagtgtcttttttgtataatgacttcttttcttctgggtggattgctgga

--------------------------------------------------------------------------------