Gene ZNHIT1 Variant 1
DNA : 6.02 KbNT_079596
mRNA : 725 bp NM_006349
CDS : 465 bp NP_006340
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  52 bp
gatttacacctccacactgaggccggaagtggttttgcccctataaaacatggcgaaaag
ctttcttgtctccaaggaaacgccacgtaatgagtcaaagctgtggcgcacgcgcagaag
tacaagctaccggaagtgatggcgcccctactaaagccttggggttagtacgcgtgcgca
GCAGTTTCTTCCGACAGTTGTGTTGTGCCAATGGTGGAGAAGAAAACTTCGG
gtatgtgagcccccgcggttcgcccccttccccttcccaagtcagtcctagaattttctt
acctagtcattcctcttttttggtctcgctctttcgcctaggctggagtgcagtggcata
gtcatagctcactgcagcctcgatttcctgggatcaaaccatcctcccacctcagcctcc
EXON 2  171 bp
aggaagtgtgggcccagggcttggcccgggaggagacaaggggaccaagggcttggcaat
ggggatgagatcagagagctgcagcttccaccccgggtgccttcctcgccctgcccagag
cggcggccacactgctctttcttggaagccctgtaactttgcgtgccctgctccatccag
TTCGCTCCCAGGACCCCGGGCAGCGGCGGGTGCTGGACCGGGCTGCCCGGCAGCGTCGCA
TCAACCGGCAGCTGGAGGCCCTGGAGAATGACAACTTCCAGGATGACCCCCACGCGGGAC
TCCCTCAGCTCGGCAAGAGACTGCCTCAGTTTGATGACGATGCGGACACTG
gtgaggcggatggaggaggaagcgggggatgggactgagaggagggcgggagagtccgcc
caactcaggctgtgggaggacccaggagctcctggtgcctctgccagtgactggctccca
tggctgtgagcaaccacaccccctttctgtgcctcagtttcctctcgtgtatgtgaaata
EXON 3  80 bp
aacccaggagatggaggttgcagtgagtcaagatcgcaccactgcactccagcctgggtg
acagagtgagactgtctcaaaaagaaccaggagggcacatgggcatggggagtgatgaac
cagagaaagctgctgtctttctgggcaagtgccaagcaacggatcacccttgacccctag
GAAAGAAAAAGAAGAAAACCCGAGGTGATCATTTTAAACTTCGCTTCCGAAAAAACTTTC
AGGCCCTGTTGGAGGAGCAG
gtgagaggagggtcggcctgggaggaccccacagggaaggggtgagcctggcccgggcag
gtgttcgctgcgtgggtgggcggaggagttctagagccggccccttgtctctgcagaact
tgagtgtggccgagggccctaactacctgacggcctgtgcgggacccccatcgcggcccc
EXON 4  170 bp
aacccgaggtgatcattttaaacttcgcttccgaaaaaactttcaggccctgttggagga
gcaggtgagaggagggtcggcctgggaggaccccacagggaaggggtgagcctggcccgg
gcaggtgttcgctgcgtgggtgggcggaggagttctagagccggccccttgtctctgcag
AACTTGAGTGTGGCCGAGGGCCCTAACTACCTGACGGCCTGTGCGGGACCCCCATCGCGG
CCCCAGCGCCCCTTCTGTGCTGTCTGTGGCTTCCCATCCCCCTACACCTGTGTCAGCTGC
GGTGCCCGGTACTGCACTGTGCGCTGTCTGGGGACCCACCAGGAGACCAG
gtgagcatgagacctgctgtccactcccactccctccttcccacagcctccccagacctc
tctcccctcatcctggcttcccctctgtctgcaggtgtctgaagtggactgtgtgagcct
gggcattcccagagaggaagggccgctgtgcactgcccggccttcagaaagacagaattt
EXON 5  252 bp
tgtggcttcccatccccctacacctgtgtcagctgcggtgcccggtactgcactgtgcgc
tgtctggggacccaccaggagaccaggtgagcatgagacctgctgtccactcccactccc
tccttcccacagcctccccagacctctctcccctcatcctggcttcccctctgtctgcag
GTGTCTGAAGTGGACTGTGTGAGCCTGGGCATTCCCAGAGAGGAAGGGCCGCTGTGCACT
GCCCGGCCTTCAGAAAGACAGAATTTCATCACCCAATGCAGGGGGAGCTCTTCCTGGACC
AAGGGAGGAGCCGCTCATTCACCCAACAAAACTGTGTCTTATCTGCCAGGAAAGACCAGC
CTCACTCCTGGGAACTGTCTGGCAGGTAGGCTGGGCCCCCCAGTGCTGTTAGAATAAAAA
GCCTCGTGCCGG
aagccttcctgtttggtcgtggtgtgtttgaggtgatggtaatgggtcacccgtctctcc
tgctcacggctctgtctctcttcctcctgcctcccactcacccctgccaccgtccgcccc
tctgtgtccctgatcgcgagagattctgtcccattttcctgccacccccgagcccctgcc