Gene WNT2 Variant 1
DNA : 46.06 KbNT_079596
mRNA : 2310 bp NM_003391
CDS : 1083 bp NP_003382
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  383 bp
tccctaaaggttcctgtattcgcgtgtgctcgtaaccatgcagcgatgttcccccttccc
cgcctcacctcatccccagacatctcttgccatcatttcatgcacccgtgtctaaaaccc
cgcgtttctccccacccccgccaggcgcagcaccccctccctcggctgcgcccggagggg
AGCAGAGCGGACGGGGCGCGCGGGAGGCGCGCAGAGCTTTCGGGCTGCAGGCGCTCGCTG
CGCCTGGGGAATTGGGCTGTGGGCGAGGCGGTCCGGGCTGGCCTTTATCGCTCGCTGGGC
CCATCGTTTGAAACTTTATCAGCGAGTCTCGCCACTCGTCGCAGACGCGAGCGGGGGGCG
GGGGCGCGGCGAGGCGCCGGCGGCCGTGACGAGGCGCTCCCGGAGCTGAGCGCTTCTGCT
CTGGGCACGCATGGCGCCCGCACACGGAGTCTGACCTGATGCAGACGCAAGGGGGTTAAT
ATGAACGCCCCTCTCGGTGGAATCTGGCTCTGGCTCCCTCTGCTCTTGACCTGGCTCACC
CCCGAGGTCAACTCTTCATGGTG
gtaagtccacgcgcacgggcgcgggggattttggagatcggaatggggaccgcattggcc
acatagacccttcctggctgcgttcccccgcggccgcagcagtctcggattctggcccga
accctggctactgccctcttatcgccccatggtgagccccttctcttttcccagaagatc
EXON 2  227 bp
gcctgccttgccggtttctccactaaattaaaaagtaaatacccttgctttctaatatca
ccagaaggataaggaattcatatttgaaaagtgctttgaactccttagtctcccaggaac
actgagccaggcctccctgttcacgttgccctcacctctgtgttggttggtcccttatag
GTACATGAGAGCTACAGGTGGCTCCTCCAGGGTGATGTGCGATAATGTGCCAGGCCTGGT
GAGCAGCCAGCGGCAGCTGTGTCACCGACATCCAGATGTGATGCGTGCCATTAGCCAGGG
CGTGGCCGAGTGGACAGCAGAATGCCAGCACCAGTTCCGCCAGCACCGCTGGAATTGCAA
CACCCTGGACAGGGATCACAGCCTTTTTGGCAGGGTCCTACTCCGAA
gtaagtctcctgccttcacccagccctatggctctccactcatgcacagctccctcactc
catcttcaaagaccctgcttatcttctattgcattttattccatcagaagtttgttcagt
tgggcgtcattgtccctgttctacaggtgaggactagagaaatcaaggaacatgtctaga
EXON 3  278 bp
gatggttcatattaaagaaagagcctgggctctagaaaagaacccttcaagaatatcagt
accttgttgtctagtggcaaaggttgtctgaaacagagcaaatattaaacaattgtcata
tgaaagttattcagaaatagtgctaccggaccacttttaagaaaagcatttttgtttcag
GTAGTCGGGAATCTGCCTTTGTTTATGCCATCTCCTCAGCTGGAGTTGTATTTGCCATCA
CCAGGGCCTGTAGCCAAGGAGAAGTAAAATCCTGTTCCTGTGATCCAAAGAAGATGGGAA
GCGCCAAGGACAGCAAAGGCATTTTTGATTGGGGTGGCTGCAGTGATAACATTGACTATG
GGATCAAATTTGCCCGCGCATTTGTGGATGCAAAGGAAAGGAAAGGAAAGGATGCCAGAG
CCCTGATGAATCTTCACAACAACAGAGCTGGCAGGAAG
gtatggaaatgcaacggtgctcattttgtaggctgcatggctttataaaccacttaggca
gagcttatcttaaacttccctagaattgataaaatgctgtgtagtcacaacttcctactg
tcccccagccattagctgtttgttcggaagaataccaacaactaggttgaaatattccca
EXON 4  265 bp
agtcagggcaggtggctaatgtggctaacaagtgacaagcaatgcttcaacatttcccag
tcacttgccccaggatccagcatcctgagaatcacttctggattgctgggaggtaaggag
agttggagcatgtgtcacctgctcgaacctcactgaacttgcccctgtctttttcggcag
GCTGTAAAGCGGTTCTTGAAACAAGAGTGCAAGTGCCACGGGGTGAGCGGCTCATGTACT
CTCAGGACATGCTGGCTGGCCATGGCCGACTTCAGGAAAACGGGCGATTATCTCTGGAGG
AAGTACAATGGGGCCATCCAGGTGGTCATGAACCAGGATGGCACAGGTTTCACTGTGGCT
AACGAGAGGTTTAAGAAGCCAACGAAAAATGACCTCGTGTATTTTGAGAATTCTCCAGAC
TACTGTATCAGGGACCGAGAGGCAG
gtaagttcaaaagactttctttatagtacctaattctttcaacaattgatactccacaat
ttaaatgaggttctgtattttcagcctgctctctttaggttcaaagctcacgatccttat
cattcttattgaaactgtacagggctgggcgcggtggctcatgcctgtaatcccagcact
EXON 5  1157 bp
gctggcataatgggatttgcacacatggcatgggcccacagaacgagtataacagcccca
ggctgtaggaagagagggtcagggctctgtcctggaggatggacctcgtgactcctcctc
tggaggcatattggattccacccagaccttttcagtaacactccctggcttgtcttccag
GCTCCCTGGGTACAGCAGGCCGTGTGTGCAACCTGACTTCCCGGGGCATGGACAGCTGTG
AAGTCATGTGCTGTGGGAGAGGCTACGACACCTCCCATGTCACCCGGATGACCAAGTGTG
GGTGTAAGTTCCACTGGTGCTGCGCCGTGCGCTGTCAGGACTGCCTGGAAGCTCTGGATG
TGCACACATGCAAGGCCCCCAAGAACGCTGACTGGACAACCGCTACATGACCCCAGCAGG
CGTCACCATCCACCTTCCCTTCTACAAGGACTCCATTGGATCTGCAAGAACACTGGACCT
TTGGGTTCTTTCTGGGGGGATATTTCCTAAGGCATGTGGCCTTTATCTCAACGGAAGCCC
CCTCTTCCTCCCTGGGGGCCCCAGGATGGGGGGGCCACACGCTGCACCTAAAGCCTACCC
TATTCTATCCATCTCCTGGTGTTCTGCAGTCATCTCCCCTCCTGGCGAGTTCTCTTTGGA
AATAGCATGACAGGCTGTTCAGCCGGGAGGGTGGTGGGCCCAGACCACTGTCTCCACCCA
CCTTGACGTTTCTTCTTTCTAGAGCAGTTGGCCAAGCAGAAAAAAAAGTGTCTCAAAGGA
GCTTTCTCAATGTCTTCCCACAAATGGTCCCAATTAAGAAATTCCATACTTCTCTCAGAT
GGGAACAGTAAAGAAAGCAGAATCAACTGCCCCTGACTTAACTTTAACTTTTGAAAAGAC
CAAGACTTTTGTCTGATCAAGTGGTTTTACAGCTACCACCCTTAGGGGTAATTGGTAATT
ACCTGGAGAAGAATGGCTTTCAATACCCTTTTAAGTTTAAAATGTGTATTTTTCAAGGCA
TTTATTGCCATATTAAAATCTGATGTAACAAGGTGGGGACGTGTGTCCTTTGGTACTATG
GTGTGTTGTATCTTTGTAAGAGCAAAAGCCTCAGAAAGGGATTGCTTTGCATTACTGTCC
CCTTGATATAAAAAATCTTTAGGGAATGAGAGTTCCTTCTCACTTAGAATCTGAAGGGAA
TTAAAAAGAAGATGAATGGTCTGGCAATATTCTGTAACTATTGGGTGAATATGGTGGAAA
ATAATTTAGTGGATGGAATATCAGAAGTATATCTGTACAGATCAAGAAAAAAAGGGAGAA
TAAAATTCCTATCTCAT
attatgcatgtgacccatggaatctcataactgaaatgacttgaaggatgaaaattttgg
ggatacaagattggtgaactaaaatgctgacagagaggtttccagagctaactcgtgcct
ggggcggccttacaataagcagatgcctgaaagaagtcggccacatccgccgtctgctaa