Gene TRA2A Variant 1
DNA : 26.94 KbNT_079592
mRNA : 1542 bp NM_013293
CDS : 849 bp NP_037425
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  174 bp
ccaggttgagagcgcagaccgcccgccaacctccaccctcgctccaggcccagccgacac
aaagcctcgcgggaggtggagcctcgtgacgtcacagagacgcccgccccctttacgtcg
tgctctgaggaggccaggagatttctggcggcgccggcgccattttgctggagcctgcga
CCGAGTGGGAGTGGAGTGGAGCGGCTGTGGTTGCCGACTCTTTCCTCTTCCCCACGGTCC
AGTCAGCGGGTTAATTAGGCCATCGGCCCTCGAGCCGAGACTTGTCTCTTATTTAGTTCT
GGGGAGCGCCTCGTCGACATGAGTGATGTGGAGGAAAACAACTTCGAGGGCAGA
gtgagtacaaagccgcgggagccgtctaggcggcggcccaatgctcggggtttcacggga
acaagcgcggtcgggcggggttgcgggtagtcccgcgaggagcaacctctggagccatcg
cgattgattcctcccatcccaagatggcttctgggttccactccttccccaaacaccacg
EXON 2  134 bp
attgaggacagttagcagtattaacagtgggttattattgagctgaaattttttctggag
ggtgttgtctaaccatttgtttttcaggagcaatcaatataaataattacggtactttaa
atgttaggtgttaggcatctacatgaccagtgccatttgtaatactgtcttctttgttag
GAGTCTCGCTCTCAGTCAAAATCTCCAACGGGAACTCCTGCTCGTGTAAAATCGGAGAGC
AGGTCAGGATCTCGTAGTCCATCAAGGGTTTCCAAACACTCTGAATCCCATTCTCGATCA
AGATCAAAATCCAG
gtaagtgtgtttaagataatacttaaaatattcttctggggtttttgaggacaaagcagt
tgttggctgcattttgtgtagaaatttcacgaaagactcaaaattatagtttttctcaga
ctgctctttgtaaatgaatactatatcccagacaaagacttggaagtatggcttgagccc
EXON 3  166 bp
ttgactgagaagagtggaagatgtagtgacttaagtgaaccaaaggaagaataccctttc
ctcagaagcaaggaggaaggacctgagaatagttagggatatatgtataccttcttggaa
gagggaaggactttagccattttgtttcagtatttttacctaaatgtatttctctcaaag
GTCGAGGTCAAGGAGACATTCTCATAGACGTTACACTCGATCCAGATCCCACTCTCACTC
TCATAGGAGACGATCTCGAAGTAGATCATATACACCAGAATACCGGCGGCGAAGGAGCCG
AAGCCATTCTCCAATGTCTAACCGGAGAAGACATACTGGCAGCAGG
gtacgtggtttataaaagttaatgaagacttattttctcttttatgtgtttagtcatggc
atatcttgcttttaggggagcttggccattgtttagaagtgatactctggaaacatcctt
aataagctgctttagctttcaaagtaaaggaaatgccaccatctttcgtaagcttaccat
EXON 4  189 bp
ggtgtactgtgaattgtaaaatatggctcatctgctctagttctcttaaaatcttatctc
caaattattagaaacaatatatttattgtgtattagatgaggtgttctaaacaaagtatt
tctgtgtttctttgattttgattttaatttggagttttaaataatatttccattcaatag
GCAAATCCAGATCCCAACACTTGCCTTGGAGTGTTTGGCCTCAGTTTGTACACAACAGAG
AGGGATCTTCGTGAAGTATTTTCTCGATATGGACCATTGAGTGGTGTCAATGTGGTTTAT
GATCAGCGAACTGGGCGATCTCGAGGATTTGCTTTTGTGTATTTTGAGAGAATAGATGAC
TCAAAGGAG
gtaaatttgtcttttatatgcctgattatagtactgaattagtgtgaaaagttgattaat
agacttatttctgtaaacattgcatccttttttcttcctttttttctttttttttttttt
aaagataggatcttgcgtccaggcgcggtggctcatgtctgtaatcccagcactttggga
EXON 5  116 bp
tgtgttctggacattgttgaggtctagaattgtctatacaatgccctgtacaagctacat
tgctgtcattttcaaaatcaggagtttatttggattacatatactttgtgcttaatttta
agtaatgattacttcaagactggtgaattatacgtgactttttgtgcctgttctttatag
GCTATGGAAAGGGCAAATGGAATGGAGCTGGATGGTAGAAGAATTCGGGTGGATTATTCT
ATAACCAAGAGAGCGCACACACCAACACCAGGCATCTACATGGGCAGACCAACTCA
gtaagagttcaagtttcctaagctaaactatgaaatccaccagaaatatgtgcaaaattt
tgattactcagaaacttttttcctataattagaattgattctggcaaggggcaacatggc
aaaaccctgcttctactaaaaaaaaataaaaaatcagccaggtgtggtggcacatgcctg
EXON 6  129 bp
atgtagggaataaggcaaaccagaataccatgggagtcagtaaaatgagatacggaggca
atttctcatgaaagggatgttcttcctcacttttctcttttttaagccattcaatttgta
ttaaagtgtcctggaaaatagtcattcacactaatggagaatttttacatttttctgcag
TAGTGGTGGGGGTGGTGGAGGAGGCGGCGGCGGTGGAGGTGGAGGTGGTGGCAGACGTCG
AGATTCTTACTATGATAGAGGATATGATCGTGGGTATGACAGATATGAAGACTATGATTA
CCGATACAG
gtaatgttttaacttgagctttctgttctaaattagatgatagtagtgttacttggcact
tttatgttggatacatatgaataaaaacttgatttttaaaatagatcatatatgacgcct
ttgggagcagaagttagcagtctgtatatgtcagtattttgttgtgctatatacttttct
EXON 7  68 bp
tatatgtcagtattttgttgtgctatatacttttctggtctcattggcagaaagagaact
taatattaagtagttatcaccttaggtacattattattttgaatgatgaggaatttttat
tttcatctgcctcagtggagtgattatatagtatgctaagtaatctttcatttcttacag
AAGACGATCACCTTCTCCTTATTATAGTCGATATAGATCACGATCAAGATCTCGTTCCTA
CAGCCCAA
gtatgtgaactttacttttgtagcataaaaaacctcatttctaattaatggcttacttta
gaatattagagtataaggtggaaggtggcagttaatagttggaaaaatatgaggcaaatt
aaactataattgttaactttttttttttttttttttttttgctttttctcttttaggacg
EXON 8  566 bp
ccaagtatgtgaactttacttttgtagcataaaaaacctcatttctaattaatggcttac
tttagaatattagagtataaggtggaaggtggcagttaatagttggaaaaatatgaggca
aattaaactataattgttaactttttttttttttttttttttttgctttttctcttttag
GACGCTATTGATAACGGAATGGTTGCAATTAAGGACATTTTTTTTCCTCTTTTTTTTTTT
TTTTTTTTTAATTCTGAGATTTCCCCAAGCTGTGGATTCTTCCTACTCCTTAAGAAAAAA
ACTTTGGTTTATTTAGCATCTACACTTTTGTCAGTTGTGTTGCTGTTTTCCACCCATTTT
ATTATACTCTTAAAAGATGTAATTGTTGTCATTTTGAACAGTTAAACATCTTGAGTATAA
AAAGAACCCCAATGTTATGTTATGCTTTGTAAATTTTTTTTTTTGCTTTTACCTAGATAA
ACTTCTAGCTAATCAAATAAGGAAAGAAACTGTCTTTTTAAAGCTTCTTTTGTGTTAGAT
ACTGTATTAGAGATCTGCATTTATCATGAGTTCCTTTTTTTTTTTAACTTTATTTTTGGG
AAAGTAACACATGAAGTAGTTCAGTCATGTCAGGTTTGTCTGGGGTGGAATGGAACAGTC
AGGTAGTTGAAAGTTTTTTTTTAGAGATGAAAAGCTTGTGAACTCCTGTAAAACATGCTG
TATTTGAAATACATCTGTTAAAACTT
aaaaactaaagtgtgattttttttgttgttgttaagtttattgaagtttattcccttaat
cagtgaaggacaacccttatttattacctagagcagttgtataattcgctgttagaaatt
ttggtattgggacagtggataagcaggttatcacatagcatagaattcttaaaagataca