Gene TOMM7 Variant 1
DNA : 9.90 KbNT_079592
mRNA : 458 bp NM_019059
CDS : 168 bp NP_061932
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  196 bp
gaaggaaggaacacctgaagatgcgttttaaaaatgggtaacagaaacgcgaagttaccg
ccagccatgatcgcaaccacgcatgcgcctactactgccggcgaggcggaagagcaggga
aggttaaaggcgatgaattacgacctctgctggcgacgctcacgactcctgccgtaaagg
CCGTGTGTGGCGCCTGCGCACCTCCTTTCCCTTTCGGATTCCCGACGCTGTGGTTGCTGT
AAGGGGTCCTCCCTGCGCCACACGGCCGTCGCCATGGTGAAGCTGAGCAAAGAGGCCAAG
CAGAGACTACAGCAGCTCTTCAAGGGGAGCCAGTTTGCCATTCGCTGGGGCTTTATCCCT
CTTGTGATTTACCTGG
gtcagtgggagaagaaccgggaaagtgactggagggaagagggtggcggagacagcagcc
ccatttttggccgtcgggggagggagagaaaaataggggacactgccgtgcacggcccct
gaggctgtctggtcaagtggggccgatctaacctgagttcgagttcccgttctatcgctt
EXON 2  49 bp
atactctaatgaagattggagacttctgtagcgtaggtaaatttagatagtactggttgg
tctagatatcattctaactatcctaggttggattacaaagaagaaaaagtcttgattgta
aatgttttgtctgctggggttttaattaatattttttctcttctgtcttccttgattcag
GATTTAAGAGGGGTGCAGATCCCGGAATGCCTGAACCAACTGTTTTGAG
gtactgctcttaaaactaaacatttcaggacaaatgttcatacagtagtactgaatcact
aagatgtaaaagagtaatagtggcaggccttgaaatggagctttatcagtcagtatagtt
ttgggctattggaaaactgcaactactttctcttccccctcctaatttgtatttactgta
EXON 3  213 bp
tgaatacagttctgtatatttaatttgtttgttcagtgggattgatccttgtctttcaca
actgaatttgatagatgaggaaacaaacataaatgtataaaattttctaggtcttaggtt
atgtctagaagatttttatttcggaatttaatttctttcttctcttcacaaacattttag
CCTACTTTGGGGATAAAGGATTATTTGGTCTTCTGGATTTGGAGGCAATCAGCGGACAGC
ATGGAAGATGTGTGCTCTGGCTCGGATAAGAGATGGGACATCATTCAGTCACTAGTTGGA
TGGCACAAGGCTCTTCACAGACGCATCTGTAGCAGAGTGGAACTTGTACTAACTTATGAT
AGAATGTATCAGAATAAATGTTTTTAACAGTGT
tatgcttgagtcttttttgaattgaacatgctaggattatcaggtaaaaattaagccttt
tggtactttctcaaaacagggaatttatgtgtgtacctaggtgctatttaagcctgtaaa
tcccagcactttgggaggccagggcgggtggatcacgatataaaaaaatttttccaagtt