Gene TES Variant 2
DNA : 35.80 KbNT_079596
mRNA : 2584 bp NM_152829
CDS : 1239 bp NP_690042
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  46 bp
gcaaataaataggaggttttgagggctgtttatgagcgcattccattacagtgtctttca
gcggagccagagctcagccaatcctaattaagaagcaatttcagctgcagtcattgctta
ttataataattgtgacatttttatagccctacattgtctttctcaaagtaacggattcag
GAGGAGTCCTTTTCTGAGTAGAGTCCACAGAAGAGGTATTCTATTG
gtaagcatttcaaatgacttccttcatacagtagtataaaaataatttgatagcagtccg
tttgaaaaatgtttataaggaaccagcttaaactgatcagatggaatatattttcatcag
tcgcttacctgaaataagtacaaaccttttttattttttaaaaggggggcctaaatttcg
EXON 2  86 bp
atgttatgtatgtacttggaactgccatgtacatacctgggtatcatcattgactaaata
taagatttgtttgaaagttatctcaacacaagtggtaagtggaattaaaagtgcaattta
ttgaatttttagatttgtaaagaatctaataacagattcatgatgttttctttttaacag
ATGGGCTTAGGTCACGAGCAAGGATTTGGAGCCCCTTGTTTAAAATGCAAAGAAAAATGT
GAAGGATTCGAACTGCACTTCTGGAG
gtattgttttgaaaactgcaaccacattagtaatttatactttttgcaatacttcctcag
acagtggagatatcttcgagttctccagcatggttgctaagttgcagacctgttactgtc
ttttctgagaaatgaatacaacataaaaagtgttctgtcttactgtcattaagtttgact
EXON 3  253 bp
cgtgttttgtttccttcttgcttaaatatatggatacttattctccctcctaaaaaagga
cttgcctttgcataccatgatatagaataggcctaaaagtattttatgaactataaatgt
atgaacataaatatcaattaggtacaattaatcattttctacttattttcaaaattatag
AAAAATATGTCGTAACTGCAAGTGTGGCCAAGAAGAGCATGATGTCCTCTTGAGCAATGA
AGAGGATCGAAAAGTGGGAAAACTTTTTGAAGACACCAAGTATACCACTCTGATTGCAAA
ACTAAAGTCAGATGGAATTCCCATGTATAAACGCAATGTTATGATATTGACGAATCCAGT
TGCTGCCAAGAAGAATGTCTCCATCAATACAGTTACCTATGAGTGGGCTCCTCCTGTCCA
GAATCAAGCATTG
gtaaatgatatggaacagagagtttctttattgaagttcctggagtatttatttggggca
gtttctttgatgacctaatcaacttcacacatcccagatctgttattcttccggggttct
cattactttgacttctgattcctgttctagtcttttgaatgtaagactagatacttcata
EXON 4  336 bp
aactaaatctatttagtgtaccgtttttgagttttaacttcttaatatactgtgagggtg
agttgctgctattggatagaacccacttctttcttaagtaacttgcttctgatgtgtgtt
atgaaacatcacactgcctaatggccaatcccagttaacattggcctccttgtggttcag
GCCAGGCAGTACATGCAGATGCTACCCAAGGAAAAGCAGCCAGTAGCAGGCTCAGAGGGG
GCACAGTACCGGAAGAAGCAGCTGGCAAAGCAGCTCCCTGCACATGACCAGGACCCTTCA
AAGTGCCATGAGTTGTCTCCCAGAGAGGTGAAGGAGATGGAGCAGTTTGTGAAGAAATAT
AAGAGCGAAGCTCTGGGAGTAGGAGATGTCAAACTTCCCTGTGAGATGGATGCCCAAGGC
CCCAAACAAATGAACATTCCTGGAGGGGATAGAAGCACCCCAGCAGCAGTGGGGGCCATG
GAGGACAAATCTGCTGAGCACAAAAGAACTCAATAT
gtaagtagagtggtcacactgttagcctgatttgtatactttacagaatttttttccctt
actttgaacttttttggggactattcctctgagtttccaaaagggaataagtatggggaa
taaataggatttagattcagtttagacttcccacagagggtcatcgtgtttgaaacttct
EXON 5  216 bp
ggctgaggcaggagaacggcgtgaacccaggaggcggagcttgcaatgagccgagatagc
accactggactccagcctgggcgacagagtgagactcagtctcaaaaaaaaaaaaagaaa
gaaagaaaagaaatggcagtcttctaatgactaggttgttctggatggcttccctttcag
TCCTGCTATTGCTGCAAACTGAGTATGAAAGAAGGTGACCCAGCCATCTATGCCGAAAGG
GCTGGCTATGATAAACTGTGGCACCCAGCTTGTTTTGTCTGCAGCACCTGCCATGAACTC
CTGGTTGACATGATTTATTTTTGGAAGAATGAGAAGCTATACTGTGGCAGACATTACTGT
GACAGCGAGAAACCCCGATGTGCTGGCTGTGACGAG
gtatgttctatgggaccaccggcatgctggtgccctcttagaccctcatatggtcccttt
acctagaaggcaacaagacttgaccaaacagcagttgctctgtttacatccaaagaagtt
ttaaaaaataaacttctgatatcattcattctgtctgtgttaattgggttgacaaatgaa
EXON 6  159 bp
attgggttgacaaatgaaagactagaaatataaaagattgatttagactaaactaagtga
tagcataagttcaagctttaggttatcattttcaaactttagaccctgagaaagtatgtt
gttacagatataaatctcttattatataaaaatccatctttatttttatcttcttcctag
CTGATATTCAGCAATGAGTATACCCAGGCAGAAAACCAGAATTGGCACCTGAAACACTTC
TGCTGCTTTGACTGTGATAGCATTCTAGCTGGGGAGATATACGTGATGGTCAATGACAAG
CCCGTGTGCAAGCCCTGCTATGTGAAGAATCACGCTGTG
gtgagaagtgttctaaggatatggttgcctcagcctgctttaggacttgagtttatgctt
ttcttaaagcctcttacaaatgggaaacagaaagcagtcctcctaagtagaaagcaaatt
attcctaccacagggtgttaaaatcaaggcaattcaaaaacaatacatgcattgactatg
EXON 7  1488 bp
atattgacctccattaacagttggccaaaaaggttagctagaaggccaccctccattgtg
tatttctgaggttgtcattatgagttttaatttatcatctaaagaaatatgtcctaagat
gaaaatgttaccattacagcttgatctctcaccctcttctcttgtattatttcttaatag
GTGTGTCAAGGATGCCACAATGCCATCGACCCAGAAGTGCAGCGGGTGACCTATAACAAT
TTCAGCTGGCATGCATCCACAGAGTGCTTTCTGTGCTCTTGCTGCAGCAAATGCCTCATT
GGGCAGAAGTTCATGCCAGTAGAAGGGATGGTTTTCTGTTCAGTGGAATGTAAGAAGAGG
ATGTCTTAGGAGGAGGGCACCCAGAAGTATCGAGCCATAGCTATCCAAAGTGGTCTGCAT
TTCTACTGTAAAATGCAATTTGAAAAAAATAAAACGCAAAAAAAGAAACTGTAAAGGAAA
CCAAGAGATTTTGTTTAATTTTTTTGGCCATTTTTTCTTCATCAATTTTTTTTCGGTCTC
AACTTTTAAACTTGGTTTAAGCATTTGATTTGTAAAACAGTAAATAATTGTATCTTTCCA
TAGCTTTTCAAATGTGAAATCATTTTTGGAAGCTTGGATCTCATTAAACTTCATGTCTCT
ATTCCATTTGTGCCACACACTTAAAAGTTAGTGTACTGAATGGAAAGATGAGCATTCCTA
GTTCTACACTTCTTTTTTCCCCCTCATGTGTAAAATGAAAAGAAAACTAAATTTGCCCTA
ATACCAAGGCGCTACGTTTATTGCCTCGTCTTATTCACTGACCTTTGTAATGATACACAG
TGAATTCTTTTTGACAAAGAGAAATGCAGTGTAGTATGCAGAGCTGCTGTTTTAATGCCT
ATGCATTTACTCTTTCCTGATTTAGGCAGAGGTGGCATTTTCTTTATTGCATTTCTCTAT
TTTTTTAATGTACCCTACCTTCAGTATTCTCTTTGTAAGTTGGTGACTTGCATCTGTGGC
CTTGAATATTTTATTATCACATGTGGCATAACAGTATCCACACTTTTTAGTTCTTTATTT
TTTTTTTTTTATTTTGAGCAATTCTCCTGCCTCAGCCTCCCAAATAGCTGGGATTACAGG
TGCATGCCACCACACCCAGCTAATTTTTGTATTTTTAGTAGAGACAGGTTTTCACCATGT
TAGCCAGGCTGGTCTCAAACTCCTGACCTCAGATGATCCGCCTGCCTTGGCCTCCCAAAG
TGCTGGGATTACAGGTGTGGGAGCCACCATGCCTGACCCACACACTTTTTACTTGTATAG
ATGATTTTTGGCTTGGACATAAAAGCCAAGCCACCCATTTGCTTTTAATCCAAAGAACAT
GTATAGTTTTTGTACCCAGAGACTATGATTTATATTGATTGCACTTGCCTGCCATGATTT
AGATAAGATTTTTTTTGCATGGTTTTTATTCTTTCCTAATGGATCCTGTTTTATAATACT
TCCAAGCCTGTCCATGGATATATCAAATGTCTTCACTTGTATATTTTCATGGCTAGGTAT
TTCTAATGTTTATTCTTCCCTGTGTACTTCTACACATAGCTATGCACTATGAAAATTAAA
TGGAATGAATGATATGTATATTACTCAAAATAAAGTTTCTTTCACTTT
aataatcattgtatctttttattcatatccttttttgagtgaaaaatgcttctgcaacta
agcatgtgttacagcagggggcgatgtctccaaggataaaaattacccaaacgaaaataa
aagtctgcctctgacaggacagcacagaatctagatgtttcattatggagaaaagataag