Gene STK17A Variant 1
DNA : 43.00 KbNT_079592
mRNA : 2643 bp NM_004760
CDS : 1245 bp NP_004751
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  323 bp
cggccacggagtgaggccggggcggggtcgggcgcggggcggacgtggggaggggttggc
cggggccagaagcagggtgcagggcaggcgcggggcggtcacgggggcggggccggtcgc
ggggcgcggggcgggcccgagctaccggtagtctgcctgccgcagtccgagcgccgcgct
GGGGAGAGCGGGTGTTTGAAGGCTCCGCGGACCGGCACTAGGAGCCGGGGGCGGGTCCGT
GACCCTCCGGCTGCTCGGAGTGAACAGGCGGCCAGGAAAGAAGCGGGCCTGAACACCATG
ATCCCTTTGGAGAAGCCAGGCAGCGGCGGCTCCTCCCCAGGCGCCACCTCAGGCTCGGGC
CGGGCAGGCCGGGGTCTGAGCGGGCCGTGCCGGCCGCCGCCGCCGCCCCAGGCCCGCGGG
CTGCTGACAGAGATACGCGCCGTGGTGCGCACCGAGCCCTTCCAGGACGGCTACAGCCTG
TGCCCGGGCCGGGAGCTGGGCAG
gtgaggacgggcggggcccggcgcggaaccttcccggacgcgcggggcgggacgtgggcg
ccgataagtgccggcgccgcggcggcgaggctgaagtggcgttgctgctgccgataacgc
gcgttgtgacttggcacaaacttgggtgccgacggcaagtagggcagccgagtcgcacca
EXON 2  213 bp
tgataaatctataaatctatagatgtagcctatataaatttctaagtgatgtttctactt
ttgtgattgtatataagctaaatttgaatatctaccaatgggtatttggaaatttcattg
aaatctgccatctctggaaagttgtcaactttaacagtgaatgtttttgtttaattctag
GGGGAAATTTGCAGTGGTGAGAAAATGTATAAAGAAAGATTCTGGGAAAGAATTTGCTGC
AAAGTTCATGAGAAAAAGAAGAAAAGGCCAAGATTGTCGGATGGAAATAATTCATGAGAT
TGCTGTACTTGAACTAGCACAAGACAATCCTTGGGTCATTAATTTACATGAAGTTTATGA
GACTGCATCAGAAATGATCTTAGTTCTGGAATA
gtaagtattgtctttcttagattaagtttgtttggtagtctacacttcctttacggaatg
ccactcatctgtgataatgttgccaggcctggttctctggaaatctcagaattttctaga
tcatcttcaggtgttcctcttattaatataacatgttccaaatttgcaaggatgcatgta
EXON 3  145 bp
gtttgagaccagcctgggcaacatagtgaggtcccatctctatttttcaaaataaaaata
cattttttaaaaaaggtatacagttactgccagactgtaattaatttactctgtagtttt
ggtgtaagtgttcgccatttcttatgagttatatattactttaattttgcccttctctag
TGCTGCTGGGGGTGAAATCTTTGACCAGTGTGTTGCAGACAGAGAAGAAGCCTTTAAAGA
AAAAGATGTTCAAAGACTTATGCGACAGATTTTAGAAGGTGTTCACTTTTTACACACTCG
TGATGTAGTTCATCTTGATTTGAAG
gtaagattcaaattacaattttgagattgctaaagaatgacattcaagacataaaatatt
taacagtgatttattcaaacatgtttcacgtttgtgtattattaggtaacaaggatatta
gaattgagtctttactcctatcctctagccagttagttttatcagggagataatgcacac
EXON 4  127 bp
gtacaggcctgctgccttatacataggcaataaattgtaaaaatatttctttaacaaatg
actgtttactgttaaattcctcagtctcagtttcataggtgaaatatgttttatgggctg
catgttttgtgtacttaatcatagttatattgatttttgcgggggtgtattttcttttag
CCTCAGAATATTCTGTTGACAAGTGAATCTCCATTGGGTGACATTAAGATTGTTGATTTT
GGCCTTTCAAGAATATTGAAGAACAGTGAAGAGCTCCGAGAAATTATGGGTACCCCTGAA
TATGTGG
gtaagtattcataaaagtagttttgttctggggtcaggcatcaccttcattaggggactt
gtccatgtggcatgactcatagtggagccagctatctactatgttgaaattctaccatca
gagatctattcctttggattacattttacaatggaaaacgttcaagagtaagataccaaa
EXON 5  49 bp
ttaattacaaacatctagttaggctttatattaattcatattaatttatggtaacctttc
attttagcccaaacgttggatagtgccttatagtttctaatgcttagttttttatctctt
agagcaaattaggaatttttttccacaaaactaaatgttttcttctctttctgatactag
CTCCTGAAATTCTTAGTTATGATCCTATAAGCATGGCAACAGATATGTG
gtaagagttattaatgaaaaattgatcaaattagtttcaagaaatgagtatggtactaaa
tttttcttgcattttctttctaatttaggagcattggagtgttaacatatgtcatgctta
caggaatatcacctttcttaggcaatgataaacaagaaacattcttaaacatctcacaga
EXON 6  180 bp
tttttccacaaaactaaatgttttcttctctttctgatactagctcctgaaattcttagt
tatgatcctataagcatggcaacagatatgtggtaagagttattaatgaaaaattgatca
aattagtttcaagaaatgagtatggtactaaatttttcttgcattttctttctaatttag
GAGCATTGGAGTGTTAACATATGTCATGCTTACAGGAATATCACCTTTCTTAGGCAATGA
TAAACAAGAAACATTCTTAAACATCTCACAGATGAATTTAAGTTATTCTGAGGAAGAATT
TGATGTTTTGTCTGAGTCGGCTGTTGATTTCATCAGGACACTTTTAGTTAAGAAACCTGA

gtaagtattatttttattagtttaatattgaactaattcaatattaaaaaattcagtatt
aaaaaactgacagttttttcttgaatctcctccaaccaaaaatagttcaacttctaaaac
accataatggaaacacaaaaatgttgacataaatctaggtgaaacccttggcttaatata
EXON 7  1606 bp
tcagcattgtgggaaattgcacccaaattccaagactaatagttttattcaggaatcaca
gtaagatttttgccaacttgtcagacttcccaaaatataatgcaataaatacagtacctt
atgctctaattttaattgaagttctaacatgtcttaactgtaaaacatgtatctttacag
AGATCGAGCCACTGCTGAAGAATGTCTAAAGCACCCCTGGTTGACACAGAGCAGTATTCA
AGAGCCTTCTTTCAGGATGGAAAAGGCACTAGAAGAAGCAAATGCCCTCCAAGAAGGTCA
TTCTGTGCCTGAAATTAATTCGGATACCGACAAATCAGAAACCGAGGAATCCATTGTAAC
CGAAGAGTTAATTGTAGTTACTTCATATACTCTAGGACAATGCAGACAGTCTGAAAAAGA
GAAAATGGAGCAAAAGGCCATTTCCAAACGATTTAAATTTGAGGAACCTTTGCTACAAGA
AATTCCAGGAGAATTTATCTACTGAGCAATATTTCCCTTTAGAACTTCAAGATTTCTACA
TTGAAAATGTTAATATTATTTATGGACCTCTGGCCAAATGGTACATGTACTGGAAGTGGA
TAACCAGTATCACTTACACAAACAAAAATAACTTTGTCAAATTTGTGGAGTTAGGTGGAA
GCCAGATTTTAAAAGTTGCCAACCAGGAGATTTAACAGGTACAGTTACCCGTTTCAATGT
TATTTTTAAGAAGGGAGATGTTGGCACCTTTGAATTCTACATCCTGTTTCTCCAGAATGA
GAATTTGTGTACAAAGATATTTGTATTCACTTTCTTTAAAAAATCCAAGTAAAAGTGCCA
AAACTACACTTCTGTAAATCTCTTGCATTATTCATATGTGTATCTATATCTGCATAATGT
TTGTTAATGTCTACTAAAATTGCTACTTTTTCACTTTGGATTTGTTTTTGGCAAAATTTT
AGTCTAAACAGACATCTAAATTTTCGAGACTTAGAATAACATTCACTAAAGTTTGATAAT
GTCTTTTTTAAATATTTTCTTACTGCTTTATAGTGACTTGATTTGGTTTCTGTTGTGTTT
TTGCCTAAATACTAGTAACATATCAGTGAAAAACCCTAATTTTTTTTCTCTTCAATGTCA
CTAGTAAGAGAGGTGGTAATTTTTCACCTCTGAAATTATTCTGGGTTTAGGTGTCAGCTC
TTGAGCTGCTTCCCTCATCACACCACACTCACATGCATCTGTTCTCTCTCACACTCTATA
CCCCTGCCACTTCCTGGCACCTCCCCCCATGCTTGTCATTTAATTTTGGCCACTTGTAGG
TATCAGTGTGATCTGATCAACACTCTGGTTACCTTGGTCAGTGAAAAGATGCTACTATAT
TGCTTTTGTCCCAAAGTGAGTAAAATCCCCTAGAGCAGAGAGAGAGAGAGAGAGAGAGAG
TGTCTTCATGCCAACCACAGCCTGTTTCTGCTGAGTTTCTTATCAGCCCTCAAGCTATGC
TAGGAAAAGTTATAAAATGCCAAAATATTTATAAACATTTACTTTGTCCATAAAAAATTT
ACATTGGATACTCTGTAAGTAGGAGGTACTTTGTCCCAAAAAGATGTATAAGAATGTACT
AATAGTTTTATTTGATTAGGATTGAACAGTTCAGTTGTATCTATGCCCCACAGTGACCAG
TAAAGTCCAATTAAAATATGGAAATGTAAAAGTGTATGCCGAATACCTTAAAGTAACTAA
TTATCCTTACACACAAAAGGCTCAGTGCATTAAATATTTGCCTATC
acctgtgtgctgtgtaccgtggccatgcctcgctctgcactatgaacaactcagacctgt
cccttcacggtctgattagggtgtcgcacaaagctctctccctaacatggtttctcaact
gtcaaaatcatgaaaatgacagcacctaaccactattttaaagtatgtacagtaaatacc