Gene SRPK2 Variant 1
DNA : 152.65 KbNT_079596
mRNA : 3703 bp XM_353827
CDS : 1767 bp XP_353828
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  210 bp
atttcttgtttgtattttattttgctaaattgaaaatcatcttgtagaaccatgctagtt
ctaccttaaaaaagaaaacacccctctgctttaaagaaatggtacttcctgctttcataa
acagtcatgtgcatagtttagcaaggcctgatgcctctggagctttttccctttatagca
CCATTGAATCCCAGTCCTAACAGAAGTACTGCGAATCTTGTGGCCTCATTCTGAACAAAA
GGGATTAGAGAAGAAAAATCTCTTGATATAAGGCTTGAAAGCAAGGGCAGGCAATCTTGG
TTGTGAATATTTTCTGATTTTTCCAGAAATCAAGCAGAAGATTGAGCTGCTGATGTCAGT
TAACTCTGAGAAGTCGTCCTCTTCAGAAAG
gtacagctacatctcttgcatgaacaattaatggtgtagcattgctaagaaacaaaccag
gacatatttttttttcttgtcaagtttgctatataacgtattgtcctgcatgctggtatt
gtgctgtattgaagatgtgtattggggcaagctgttctgcttttgcaaagggtgattgat
EXON 2  159 bp
tgacttatatgttgaaacactacttgaattcaactaaaatgggtgaagtgacattaaatg
acatttcttcttagtatgtgacaagttttattttttcccccatattaagaagtgctcaaa
tgcatccataatgcaagatgtacttctaagtaaatagcaattttctctctgctctttcag
GCCGGAGCCTCAACAGAAAGCTCCTTTAGTTCCTCCTTCCTCCACCGCCACCACCACCAC
CACCGCCACCTTTGCCAGACCCCACACCCCCGGAGCCAGAGGAGGAGATCCTGGGATCAG
ATGATGAGGAGCAAGAGGACCCTGCGGACTACTGCAAAG
gtgatgtgccaagcatggtggtgtggggcttgccttccccattgggctgtgtagtaattt
gttgggggaatggacaaggggaggaggtagtgatgcaaattgcttggtcttcattaaatt
agcctccttgtgtcattatcattttaaattcttaggtcattgtatagagactgatatcag
EXON 3  109 bp
caacactttttcttgttgaaagatattcctgaaaaaaatgttgtattattaaacatgttt
tagtctgcatgtattatgtagagctttctttaatgacatcaagaatgacaaaagagatga
aatgtttattactacttttcgaatattttgaatttttttctttctttcttgttttttaag
GTGGATATCATCCAGTGAAAATTGGAGACCTCTTCAATGGCCGGTATCATGTTATTAGAA
AGCTTGGATGGGGGCACTTCTCTACTGTCTGGCTGTGCTGGGATATGCA
gtaagtgttctttgtcatttgtgcatttgtttcctggagtagttcaacatctgtgttcta
agaaggtatggctgagggtcaccactgctttgttgaggtatgtgaagtgcttagcacagg
cctgcctcagctggctagattccttcctgccccctgccttagtttgaagttcatttgaaa
EXON 4  88 bp
tgattgcagtcagaggtggaattttacactgtggcatcgtgttgacacactcataatgtt
ttaggttttggcgcattttggattttacattttccaattagggatgctcaacctggatac
cagtgattctttctactgataatatagataaatagactctttttttgttttttcttttag
GGGGAAAAGATTTGTTGCAATGAAAGTTGTAAAAAGTGCCCAGCATTATACGGAGACAGC
CTTGGATGAAATAAAATTGCTCAAATGT
gtaagtactttaaaaatgtgaatgatataagaaaacttaatgacttaaaattttacagaa
agatttttctgggtaatactaaattaaagtcaagtttggctgggcacggtggctcatgcc
tataatctcagcactttgggaggccaaagcgagcagatcacttgaggtcaagagttcgag
EXON 5  88 bp
agcaagactctgtctcaaaaaataaataaataaataaataaataaagtttattttttata
actttgtgatgaattttttattttaaaatatacttttatttaaacagtattggtgttata
atgggaaaacatgctttgtctcaaactcctgtgttcttgcattcatttttcttggcatag
GTTCGAGAAAGTGATCCCAGTGACCCAAACAAAGACATGGTGGTCCAGCTCATTGACGAC
TTCAAGATTTCAGGCATGAATGGGATAC
gtatcctttacttcctgatttatttgtatttttaccttttaaaaaatgaaaatatttcaa
gctcctataatctctgtttactgctgtatcaccttcaacataaacactctaggaacattg
tcaagtattatgaagtggtccacctagaatagttttcatggctttttggggtgtttggta
EXON 6  107 bp
aatgtcagttcttgttatttaagtgagatacaacattttctcacttttggtattactgat
agggttgatgttgtattttataaagtaataagtgctttgcaagtgacacaatggtgctgc
tttcaataactgcctcactccaggcagtgcatccacaaacgatccttaactgtgtcccag
ATGTCTGCATGGTCTTCGAAGTACTTGGCCACCATCTCCTCAAGTGGATCATCAAATCCA
ACTATCAAGGCCTCCCAGTACGTTGTGTGAAGAGTATCATTCGACAG
gtgagacttttgacagcagcccctaggccctagtacctaattggttaggctttcaacatg
aatgctgtttacaaatatgtatatgtattacatatgtatcagtgcataatgtatatatgt
tatgtatgttacatatgtatcagtgcataacattttgaactcttattaagtcagtattta
EXON 7  166 bp
tatggaaaggagagctggattccaatgtgggtaggcatgggagggagatttttactaaat
atccttttgtgtttatcaaactttgtaccctggcattgtattacatgtttttcaaataaa
taaaagttatataatgagatattaatagcttatcttctctcttgattttactatatccag
GTCCTTCAAGGGTTAGATTACTTACACAGTAAGTGCAAGATCATTCATACTGACATAAAG
CCGGAAAATATCTTGATGTGTGTGGATGATGCATATGTGAGAAGAATGGCAGCTGAGGCC
ACTGAGTGGCAGAAAGCAGGTGCTCCTCCTCCTTCAGGGTCTGCAG
gtgagggagctgagccagcttcatttcagtgtgggggcattgggagcttgcaaagttgca
gttgttgaaggtatctgaatcaaacgttacacataaggaagattttggaaaagtttaatt
gctggaaataactgcacccttgaaatggaaaatgccccagctacattatattttaatatt
EXON 8  26 bp
tttgtttcagtggcataaacttactctagatccttgtgattaagaagctctgattaatag
tttttgaagttggatagccattaaaagacaataattatttcactttgcaattcgaatgac
ctacatgaaggcatgtgtctgttttctgctaaatacagattttgtttgattttattttag
TGAGTACGGCTCCACAGCAGAAACCT
gtaagtacttacgcatattactttatatgcaccatgttaaaagagaccgtttattattga
gttgttcaaattataaaaaagttgtgtatttaaagggtagacacatttataaaagctgtg
tatcctcaaataggtaagacttaatgtcttgttaattttttttttttttttttttgaaaa
EXON 9  247 bp
tgctttccctttgattttatcgtaagccttaccacaaagtggatctgtctgggtttggga
ttttaatagaatatggcatgagaaagcagagtttattgctatttgccatgctgctagtcg
ttatactatcgtggtgctttaaaaagaagaatactgacctgtggtctttccttaacatag
ATAGGAAAAATATCTAAAAACAAAAAGAAAAAACTGAAAAAGAAACAGAAGAGGCAGGCT
GAGTTATTGGAGAAGCGCCTGCAGGAGATAGAAGAATTGGAGCGAGAAGCTGAAAGGAAA
ATAATAGAAGAAAACATCACCTCAGCTGCACCTTCCAATGACCAGGATGGCGAATACTGC
CCAGAGGTGAAACTAAAAACAACAGGATTAGAGGAGGCGGCTGAGGCAGAGACTGCAAAG
GACAATG
gtcagtggggcctggaacctgggctgcatggggttctcagagctccattagtagggttct
gccaggtcaacatgggggctgatttgtgctgctgctgcagatgacaaggatgattctctc
caactccctattgggaaatatgggaaatagcctcgtacttcatttgtgaactgtatgcca
EXON 10  483 bp
ctaaatgaatgaaaaatgagatttagaaaacctgaaggttttaccccaaaagccaagagg
tgtttaccaggtggtacataagcatattcaaaatgtattttattgatggagataagtact
taatgaggctgtattaaggagagtaacaagttctaattcttgacccatcaaattcttaag
GTGAAGCTGAGGACCAGGAAGAGAAAGAAGATGCTGAGAAAGAAAACATTGAAAAAGATG
AAGATGATGTAGATCAGGAACTTGCGAACATAGACCCTACGTGGATAGAATCACCTAAAA
CCAATGGCCATATTGAGAATGGCCCATTCTCACTGGAGCAGCAACTGGACGATGAAGATG
ATGATGAAGAAGACTGCCCAAATCCTGAGGAATATAATCTTGATGAGCCAAATGCAGAAA
GTGATTACACATATAGCAGCTCCTATGAACAATTCAATGGTGAATTGCCAAATGGACGAC
ATAAAATTCCCGAGTCACAGTTCCCAGAGTTTTCCACCTCGTTGTTCTCTGGATCCTTAG
AACCTGTGGCCTGCGGCTCTGTGCTTTCTGAGGGATCACCACTTACTGAGCAAGAGGAGA
GCAGTCCATCCCATGACAGAAGCAGAACGGTTTCAGCCTCCAGTACTGGGGATTTGCCAA
AAG
gtaagtgtttcttcccatcaactgtctgccatcgctgactccagggacgtgcctttaaca
aatgctgtgaaggaattggctggaagtggccaagccctgtgtgtgtgtactgatcagttt
tattacttttatactcctgaagaagtaatgtgatttaaataaattttctatgccattagg
EXON 11  101 bp
attttccagaggtggagaacaagcaattttagttctgtcaagtttaatttacagtattcc
aggcctaagtgatcattccactactcttgaggaaaggagactgaccctggcaaacactgt
gctcacacatgcaaaccacctatcccgatcactaactgtcctgctgtttgctcatgccag
CAAAAACCCGGGCAGCTGACTTGTTGGTGAATCCCCTGGATCCGCGGAATGCAGATAAAA
TTAGAGTAAAAATTGCTGACCTGGGAAATGCTTGTTGGGTG
gtaagtagagttttctttctaaaacctttggtcttgattctgtgtgcgaagacacttttt
gaatgtctgtgttgctccgtggtaatgcagcctgttcccttccagcataaacacttcacg
gaagacatccagacgcgtcagtaccgctccatagaggttttaataggagcggggtacagc
EXON 12  108 bp
gtgaatcccctggatccgcggaatgcagataaaattagagtaaaaattgctgacctggga
aatgcttgttgggtggtaagtagagttttctttctaaaacctttggtcttgattctgtgt
gcgaagacactttttgaatgtctgtgttgctccgtggtaatgcagcctgttcccttccag
CATAAACACTTCACGGAAGACATCCAGACGCGTCAGTACCGCTCCATAGAGGTTTTAATA
GGAGCGGGGTACAGCACCCCTGCGGACATCTGGAGCACGGCGTGTATG
gtaaggacggctgtgccctttgctgccatgggaattggctcgttcctttcacactctgga
tggggctgagtctctctgaggcatgcgacctcagtttttctgactgtaagggtcatccac
cgtgggctgggtgaggggaaggttgctgccgcaggcatcttaagaagtggaaggatcctc
EXON 13  70 bp
atacttctgaaacttctttgaatgtggaagaaagaaaaaaattagtattgagcactttca
ggaggctattttgtttgattcagatcttcataaagtggcggtctcttctataaggagaaa
aagctgttgacttgggggccagtctctgaagtgcttagcatgtcgtctgttgtatcctag
GCATTTGAGCTGGCAACGGGAGATTATTTGTTTGAACCACATTCTGGGGAAGACTATTCC
AGAGACGAAG
gtgagtattggtgcctgctgaatacctcggtctaggtcttctgccagccctgaacttctg
tagagtactgtatttttgtactgaaatagagccatgtgtttggttttcaaacaccaaatt
cagatgcttttcctttgagtttgatgccccctcagtctcagtgaatgggcagagcctgcc
EXON 14  93 bp
ctgctccaggtggtgcctgaggcctgccattcccacaagcctctgcatggatgtgctgca
gacactgttgatttgaatctatttctgattttttactaatttcaatttttccctcttctt
ttatcccatccttccctttgcccctcccattcccatatcctttttttctctcctccatag
ACCACATAGCCCACATCATAGAGCTGCTAGGCAGTATTCCAAGGCACTTTGCTCTATCTG
GAAAATATTCTCGGGAATTCTTCAATCGCAGAG
gtagtacctcttctttttgaaaagcgccacgatgcagacagaaactgaagagcagctgct
gattttagcattaatggtgacaaaggcatttctcctaaattcgaaacgcaacccagcaga
attcctatgctgatagaaaaattgtcagggaagaccacatttagccctgtgctgcggtca
EXON 15  1648 bp
cttggtcatatgtacatgtaatgattattgcttagtggggaaaagctggtgttctttgtt
gttgctgtacaagtgttgagcaggtggttgtccgcttcactgaaaagaacctgactggac
caacaatggggaatgcagatttggagctttcttgacattggcctgttttttcccctgtag
GAGAACTGCGACACATCACCAAGCTGAAGCCCTGGAGCCTCTTTGATGTACTTGTGGAAA
AGTATGGCTGGCCCCATGAAGATGCTGCACAGTTTACAGATTTCCTGATCCCGATGTTAG
AAATGGTTCCAGAAAAACGAGCCTCAGCTGGCGAATGCCTTCGGCATCCTTGGTTGAATT
CTTAGCAAATTCTACCAATATTGCATTCTGAGCTAGCAAATGTTCCCAGTACATTGGACC
TAAACGGTGACTCTCATTCTTTAACAGGATTACAAGTGAGCTGGCTTCATCCTCAGACCT
TTATTTTGCTTTGAGGTACTGTTGTTTGACATTTTGCTTTTTGTGCACTGTGATCCTGGG
GAAGGGTAGTCTTTTGTCTTCAGCTAAGTAGTTTACTGACCATTTTCTTCTGGAAACAAT
AACATGTCTCTAAGCATTGTTTCTTGTGTTGTGTGACATTCAAATGTCATTTTTTTGAAT
GAAAAATACTTTCCCCTTTGTGTTTTGGCAGGTTTTGTAACTATTTATGAAGAAATATTT
TAGCTGAGTACTATATAATTTACAATCTTAAGAAATTATCAAGTTGGAACCAAGAAATAG
CAAGGAAATGTACAATTTTATCTTCTGGCAAAGGGACATCATTCCTGTATTATAGTGTAT
GTAAATGCACCCTGTAAATGTTACTTTCCATTAAATATGGGAGGGGGACTCAAATTTCAG
AAAAGCTACCAAGTCTTGAGTGCTTTGTAGCCTATGTTGCATGTAGCGGACTTTAACTGC
TCCAAGGAGTTGTGCAAACTTTTCATTCCATAACAGTCTTTTCACATTGGATTTTAAACA
AAGTGGCTCTGGGTTATAAGATGTCATTCTCTATATGGCACTTTAAAGGAAGAAAAGATA
TGTTTCTCATTCTAAAATATGCATTATAATTTAGCAGTCCCATTTGTGATTTTGCATATT
TTTAAAAGTACTTTTAAAGAAGAGCAATTTCCCTTTAAAAATGTGATGGCTCAGTACCAT
GTCATGTTGCCTCCTCTGGGCGCTGTAAGTTAAGCTCTACATAGATTAAATTGGAGAAAC
GTGTTAATTGTGTGGAATGAAAAAATACATATATTTTTGGAAAAGCATGATCATGCTTGT
CTAGAACACAAGGTATGGTATATACAATTTGCAGTGCAGTGGGCAGAATACTTCTCACAG
CTCAAAGATAACAGTGATCACATTCATTCCATAGGTAGCTTTACGTGTGGCTACAACAAA
TTTTACTAGCTTTTTCATTGTCTTTCCATGAAACGAAGTTGAGAAAATGATTTTCCCTTT
GCAGGTTGCACACAGTTTTGTTTATGCATTTCCTTAAAATTAATTGTAGACTCCAGGATA
CAAACCATAGTAGGCAATACAATTTTAGAATGTAATATATAGAGGTATATTTAGCCTCTT
TTAGAAGTCAGTGGATTGAATGTCTTTTTATTTTAAATTTTACATTCATTAAGGTGCCTC
GTTTTTGACTTTGTCCATTAACATTTATCCATATGCCTTTGCAATAACTAGATTGTGAAA
AGCTAACAAGTGTTGTAACAATAATCCATTGTTTGAGGTGCTTGCAGTTGTCTTAAAAAT
TAAAGTGTTTTGGTTTTTTTTTTTCCAG
acattgccttggtcattgccctataaatgatagaatcaatgaacatttgctatcagagta
gtgtcactaaaactaaataccagcattcctgttgcagcagatgtagttgtagaacatgca
ttgaggcgtattataaggaaatcatttattgttttttaagggcagaagggatttaggaga