Gene SERPINE1 Variant 1
DNA : 11.85 KbNT_079596
mRNA : 2867 bp NM_000602
CDS : 1209 bp NP_000593
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  74 bp
gctggctgttcagacggactcccagagccagtgagtgggtggggctggaacatgagttca
tctatttcctgcccacatctggtataaaaggaggcagtggcccacagaggagcacagctg
tgtttggctgcagggccaagagcgctgtcaagaagacccacacgcccccctccagcagct
GAATTCCTGCAGCTCAGCAGCCGCCGCCAGAGCAGGACGAACCGCCAATCGCAAGGCACC
TCTGAGAACTTCAG
gtaggagaaaagcaaactccctccaacctcttacttcgggcttaaggcagagaactcgcc
tccccagaatctcctccctccatgatcccccgctattcctctattttcttttcctcggac
ctgcagccttgggtcgaccctgccctaggggtgactgcaggagagcagggaggatggtca
EXON 2  272 bp
gagtgggatgggcttagaacctgaacatgtcatggtctcttcctgcaccttgccctagtg
ttcacttaccacctgcttgcaggaaacaagaagagcagggcccacagctggccagctccc
ctcccctcccgcctgtcttccagaacgattccttcaccagccctctttccattgctctag
GATGCAGATGTCTCCAGCCCTCACCTGCCTAGTCCTGGGCCTGGCCCTTGTCTTTGGTGA
AGGGTCTGCTGTGCACCATCCCCCATCCTACGTGGCCCACCTGGCCTCAGACTTCGGGGT
GAGGGTGTTTCAGCAGGTGGCGCAGGCCTCCAAGGACCGCAACGTGGTTTTCTCACCCTA
TGGGGTGGCCTCGGTGTTGGCCATGCTCCAGCTGACAACAGGAGGAGAAACCCAGCAGCA
GATTCAAGCAGCTATGGGATTCAAGATTGATG
gtgagccacgggacaccaggggaggtgggtggcatgcagaacagacctaccagaagccaa
ggaaaggctggctctggcttagccgagccaagccccatacagctgtgctgcaggggccac
cccatcttcttcccactacactccaagtcactggacccttgaatctccaagggtgtctga
EXON 3  234 bp
aggaaggagatacagaaaagagatttcatcctggaatgaaatctccctccagagagccct
gggaaagcacggtagcccccatccatcagagtggagccccttgtgggggaagtgggctcg
gctgggaaccctcaattcagcataagcctcacatgtcctctcctctctgtcccggtgcag
ACAAGGGCATGGCCCCCGCCCTCCGGCATCTGTACAAGGAGCTCATGGGGCCATGGAACA
AGGATGAGATCAGCACCACAGACGCGATCTTCGTCCAGCGGGATCTGAAGCTGGTCCAGG
GCTTCATGCCCCACTTCTTCAGGCTGTTCCGGAGCACGGTCAAGCAAGTGGACTTTTCAG
AGGTGGAGAGAGCCAGATTCATCATCAATGACTGGGTGAAGACACACACAAAAG
gtgagcaggcagggaaaggaaacccatttcctgggcctcaagagaaagggaatttggaaa
taaatccacatatcccagttgggtgcagtagttcacacctgtaatcccagcccaacactt
tgggaggtctaggcgagaggaaggcttgaggcctggagtttgagaccagcctggccaaca
EXON 4  195 bp
attcgggaggctgaggcaggagaattgcttgaaccccggagacagaggttgcagcgagcc
gagatcgcgccactgcactccagcctggcaatagagtgagactccatctcaaaacaacaa
caacaacaacaacaaaatcgtctaacttcctgatcttcctgatcattgattttcccatag
GTATGATCAGCAACTTGCTTGGGAAAGGAGCCGTGGACCAGCTGACACGGCTGGTGCTGG
TGAATGCCCTCTACTTCAACGGCCAGTGGAAGACTCCCTTCCCCGACTCCAGCACCCACC
GCCGCCTCTTCCACAAATCAGACGGCAGCACTGTCTCTGTGCCCATGATGGCTCAGACCA
ACAAGTTCAACTATA
gtaagtccaagagccccttccccacagcccacagcaactgcatctcattcctggggtctc
ccaaggaatacccaaaatgtcaccctctgagggaggaagaccacagggaatgctcccctt
taagggaggagagaccctagaatatactccagctttgacaaagatttcccaagcaggaga
EXON 5  199 bp
gaaattaaaatactgaataggggagcagtgaacaggggatacccaaaagccaagagcgag
agagagcctggcttccagaaatagtggagaagccaggagaactaggtgaaaacccagtgc
tgggttgccatcagcgagagctggagccatttccaacgaaccatcttgtcgtcttcacag
CTGAGTTCACCACGCCCGATGGCCATTACTACGACATCCTGGAACTGCCCTACCACGGGG
ACACCCTCAGCATGTTCATTGCTGCCCCTTATGAAAAAGAGGTGCCTCTCTCTGCCCTCA
CCAACATTCTGAGTGCCCAGCTCATCAGCCACTGGAAAGGCAACATGACCAGGCTGCCCC
GCCTCCTGGTTCTGCCCAA
gtaagccaccccgctatctccccgacctaccaacccctctctcctggctccctaaagtca
ccgcccccaggttgaatttcccagatctgtgatgcttgcaggacatgcatgtgtgggagg
ctgatgggaaactgtggcctgggtttgattatgagtcttgcaatcatccctccccctgtt
EXON 6  101 bp
agaaagaaagaaaaagaaaggaaagaaagaacgaacgaaccaggcctccctctccaacct
tcacctccgtccctattctggccacttgattcgggggacacctggtaggggatggggaaa
ggtgggagctgccagccagaggggaccccggcttgagcagcctcttgctgctatctgcag
GTTCTCCCTGGAGACTGAAGTCGACCTCAGGAAGCCCCTAGAGAACCTGGGAATGACCGA
CATGTTCAGACAGTTTCAGGCTGACTTCACGAGTCTTTCAG
gtaagaagactttcctttgcattttctcaccccagtggactgcgggggcccctaagagga
aaaaggaacctctccttgagagcggcagctgatctaatcctgtatccacatctgtttcag
accaagagcctctccacgtcgcgcaggcgctgcagaaagtgaagatcgaggtgaacgaga
EXON 7  87 bp
agaacctgggaatgaccgacatgttcagacagtttcaggctgacttcacgagtctttcag
gtaagaagactttcctttgcattttctcaccccagtggactgcgggggcccctaagagga
aaaaggaacctctccttgagagcggcagctgatctaatcctgtatccacatctgtttcag
ACCAAGAGCCTCTCCACGTCGCGCAGGCGCTGCAGAAAGTGAAGATCGAGGTGAACGAGA
GTGGCACGGTGGCCTCCTCATCCACAG
gtgagtctggctcaggtgaggctccacgggtgtcgcctccatcgcccttcaggataactg
gtccccagacccggaaaggaccccgcagccctctcggcacagagcagctctgtctgtgct
cagccatcacccactccccacctgtttctcagcctggaaaacgggcttgggaccatggaa
EXON 8  84 bp
gactgaggtgggaggatcacttgagcccatgagttcaaggctgcagtgagccatgaaggt
gccactgcactcccacctgggcgacagagggagaccctgtctctaagaaaaacggcgggg
gtgggggtggtgccagtgccagcatccctctgttctaagacattgtcccttctcttgcag
CTGTCATAGTCTCAGCCCGCATGGCCCCCGAGGAGATCATCATGGACAGACCCTTCCTCT
TTGTGGTCCGGCACAACCCCACAG
gtgagcctggaacccatcacgttccacatcctcccacccattctttctctcaggaactag
tcccgacagatgcagacatccctctatccctgagagggctctgggcagggaacccataac
cctaccctgcttcctgtcccaagaggaggctaccttctatcacccacagacagtgccggg
EXON 9  1621 bp
aagaggaggctaccttctatcacccacagacagtgccgggtccccgctctgtgactcagg
cagctgcgactccagacagctcactcatctgcctagatctcagtccttccacccacatcc
agcctgatgagctgtcccactccttctgcttctcaacccccatggttcttccaccctcag
GAACAGTCCTTTTCATGGGCCAAGTGATGGAACCCTGACCCTGGGGAAAGACGCCTTCAT
CTGGGACAAAACTGGAGATGCATCGGGAAAGAAGAAACTCCGAAGAAAAGAATTTTAGTG
TTAATGACTCTTTCTGAAGGAAGAGAAGACATTTGCCTTTTGTTAAAAGATGGTAAACCA
GATCTGTCTCCAAGACCTTGGCCTCTCCTTGGAGGACCTTTAGGTCAAACTCCCTAGTCT
CCACCTGAGACCCTGGGAGAGAAGTTTGAAGCACAACTCCCTTAAGGTCTCCAAACCAGA
CGGTGACGCCTGCGGGACCATCTGGGGCACCTGCTTCCACCCGTCTCTCTGCCCACTCGG
GTCTGCAGACCTGGTTCCCACTGAGGCCCTTTGCAGGATGGAACTACGGGGCTTACAGGA
GCTTTTGTGTGCCTGGTAGAAACTATTTCTGTTCCAGTCACATTGCCATCACTCTTGTAC
TGCCTGCCACCGCGGAGGAGGCTGGTGACAGGCCAAAGGCCAGTGGAAGAAACACCCTTT
CATCTCAGAGTCCACTGTGGCACTGGCCACCCCTCCCCAGTACAGGGGTGCTGCAGGTGG
CAGAGTGAATGTCCCCCATCATGTGGCCCAACTCTCCTGGCCTGGCCATCTCCCTCCCCA
GAAACAGTGTGCATGGGTTATTTTGGAGTGTAGGTGACTTGTTTACTCATTGAAGCAGAT
TTCTGCTTCCTTTTATTTTTATAGGAATAGAGGAAGAAATGTCAGATGCGTGCCCAGCTC
TTCACCCCCCAATCTCTTGGTGGGGAGGGGTGTACCTAAATATTTATCATATCCTTGCCC
TTGAGTGCTTGTTAGAGAGAAAGAGAACTACTAAGGAAAATAATATTATTTAAACTCGCT
CCTAGTGTTTCTTTGTGGTCTGTGTCACCGTATCTCAGGAAGTCCAGCCACTTGACTGGC
ACACACCCCTCCGGACATCCAGCGTGACGGAGCCCACACTGCCACCTTGTGGCCGCCTGA
GACCCTCGCGCCCCCCGCGCCCCTCTTTTTCCCCTTGATGGAAATTGACCATACAATTTC
ATCCTCCTTCAGGGGATCAAAAGGACGGAGTGGGGGGACAGAGACTCAGATGAGGACAGA
GTGGTTTCCAATGTGTTCAATAGATTTAGGAGCAGAAATGCAAGGGGCTGCATGACCTAC
CAGGACAGAACTTTCCCCAATTACAGGGTGACTCACAGCCGCATTGGTGACTCACTTCAA
TGTGTCATTTCCGGCTGCTGTGTGTGAGCAGTGGACACGTGAGGGGGGGGTGGGTGAGAG
AGACAGGCAGCTCGGATTCAACTACCTTAGATAATATTTCTGAAAACCTACCAGCCAGAG
GGTAGGGCACAAAGATGGATGTAATGCACTTTGGGAGGCCAAGGCGGGAGGATTGCTTGA
GCCCAGGAGTTCAAGACCAGCCTGGGCAACATACCAAGACCCCCGTCTCTTTAAAAATAT
ATATATTTTAAATATACTTAAATATATATTTCTAATATCTTTAAATATATATATATATTT
TAAAGACCAATTTATGGGAGAATTGCACACAGATGTGAAATGAATGTAATCTAATAGAAG
C
ctaatcagcccaccatgttctccactgaaaaatcctctttctttggggtttttctttctt
tcttttttgattttgcactggacggtgacgtcagccatgtacaggatccacaggggtggt
gtcaaatgctattgaaattgtgttgaattgtatgctttttcacttttgataaataaacat