Gene SEMA3C Variant 1
DNA : 176.83 KbNT_079595
mRNA : 5176 bp NM_006379
CDS : 2254 bp NP_006370
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  524 bp
ccttttaaaaacgcatctctttgccttaaaaggctgcagtgatccttccctggcaaaaat
aaaaaaccacaactgctttgcactttgatatttacggccaggcaaagcctgtgtaagtct
tcgagagccgccggcaacaaaaaccgtggagcgcacccagcaagttgctcactccgccgc
GGACTGCGAAAGGAGCAGGGTTGCGGAGCTAGGGCTCCAGCCTGCGGCCGCGCATTCTTG
CGTCTGGCCAGCCGCGAGCTCTAAGGGTCGGCCCCGCCCGGTCCGCCCCCGCGGCTCCCT
GCCAGGCTCTCGCGGGCGCGCTCGGGGTGGGGCCTCGCGGCTGGCGGAGATGCGGCCGGG
GCTGCGCGGTGGTGATGCGAGCCTGCAGGGCGGCGCGCCGGGGCAGCCGGAGCCGCGCGC
CGCGGCGCTGTAATCGGACACCAAGAGCGCTCGCCCCCGGCCTCCGGCCACTTTCCATTC
ACTCCGAGGTGCTTGATTGAGCGACGCGGAGAAGAGCTCCGGGTGCCGCGGCACTGCAGC
GCTGAGATTCCTTTACAAAGAAACTCAGAGGACCGGGAAGAAAGAATTTCACCTTTGCGA
CGTGCTAGAAAATAAGGTCGTCTGGGAAAAGGACTGGAGACACAAGCGCATCCAACCCCG
GTAGCAAACTGATGACTTTTCCGTGCTGATTTCTTTCAACCTCG
gtaagctaaattggtcattttccgcattacagatttagcaaagtataacttttttggcct
gtatattgatttttcatacattggtatgctcaagcctggacattttcttaagaacacacg
cggtttgtcagggaagctttccccttgctgagagccctgctcgagttgtttctttaggcg
EXON 2  141 bp
atgaatcaaatccacattttcacatctgagaagcaaagacacagcacctcctactgtttg
cattactgtaaaagttcagatggttcttttgtgaatagggtgttttgtctagattgctgt
tttttcctactcctaaaatgtgaaatgagatataacaaacatgttgtctctctcttaaag
GTATTTTCCCTTGGATATTAACTTGCATATCTGAAGAAATGGCATTCCGGACAATTTGCG
TGTTGGTTGGAGTATTTATTTGTTCTATCTGTGTGAAAGGATCTTCCCAGCCCCAAGCAA
GAGTTTATTTAACATTTGATG
gtaagagagttgataaacactctgggaaaaatgttattttaagttttgttatcttcctta
tccagattcagaaattaagagtataaatattactggatattaattttaaaaatatttact
gggctgcgttttggaggacaatagctattttaaatgattggttaatagacaaagatcctc
EXON 3  161 bp
ctcccaaagtgctgagattacagggaactagcccataactctattttaaaattaatttct
tactgtagaagaaaatgtaccttgacattttttggaatatttgcataatagtttttatta
aaataatagaattatagaaccaggatactgtatctacacttgtgctgttcactctttcag
AACTTCGAGAAACCAAGACCTCTGAATACTTCAGCCTTTCCCACCATCCTTTAGACTACA
GGATTTTATTAATGGATGAAGATCAGGACCGGATATATGTGGGAAGCAAAGATCACATTC
TTTCCCTGAATATTAACAATATAAGTCAAGAAGCTTTGAGT
gtaagtttatcactttcacgaggacagtgtccaccttttcaatgtctcttttttaaaaaa
aataaataagtaaaaaataatatgcattttattagaacaatagaaaatactggtcccatg
ttactatgaaagttagtacttatttcatggactgaaaaggtattaagttcagttctcatc
EXON 4  63 bp
aataattgtaattgttaaaataatagaatctttattaatgaattgataaaaaagaaagaa
ttttaaagtcttagtgtaagatcaccttaaataaatctgttaacaaaaagtaaatgaaga
gcactgggctgtcatatgtccaagtgagattatgcaacctttatttttctttctgagcag
GTTTTCTGGCCAGCATCTACAATCAAAGTTGAAGAATGCAAAATGGCTGGCAAAGATCCC
CCA
gtaagtgttaaaaaaaaaaaaaaaaaaaaaaacactaacttaaatatttggttttcgaat
ccatgtactttgagggaagccaaaaatgagacaaggatggtggtgttttaaatttttgct
ggacacaggctaaaaacctaaaccttgaggagactggaactcttgggctctctgtaactt
EXON 5  118 bp
aattcttcttccagtgtggcctagggaagccaaaagattggacgcccctggactaataca
tcaaaagtttatgtcacctcattgttacttatcatacaagatctcaggttaacatagcta
actgaaataacaatgaaagtcattgagttactaactgcttatttactgattcttttagca
CGGCTGTGGGAACTTTGTCCGTGTAATTCAGACTTTCAATCGCACACATTTGTATGTCTG
TGGGAGTGGCGCTTTCAGTCCTGTCTGTACTTACTTGAACAGAGGGAGGAGATCAGAG
gtaagtataactatttaacattcttagttttgatattagtgtcaaggatttttgaaactg
tattttagagtaaaaacttggacatatcaatattcataaaatattttcatgccctttaaa
tacaaactatattacattttttcctgtctgccaagttacttgaagtatcaccttttgcct
EXON 6  91 bp
gtaattacagatcgattcttctcatagtttgagtaaatcttaatgtagtaaattggaagg
cataataagcaaccaactagaaagcatattaattttaatgatgctttgttttactaatga
acaattgtcttcactaaataagttatcattgccacattttaaattttatctacaataaag
GACCAAGTTTTCATGATTGACTCCAAGTGTGAATCTGGAAAAGGACGCTGCTCTTTCAAC
CCCAACGTGAACACGGTGTCTGTTATGATCA
gtaagtagacaacgaaagagggaggattaaacataaaataacatggaaaattagcttgac
atggtatacctattcttgatggttgtgtggatgatagtatgtgagtaaaataatatgaag
aaagttgtgagctgagaaatagagagttcagtttctcatttgtaagaatatttatgatta
EXON 7  120 bp
gaaaagattaaaatttataaaatttattgatttgctggacaatgcaaaccaattaatatt
tgttataaccaattatcataacactgtaatacctgtggtgatctcctaataaataaactc
acctagaatttcaaaatagctttaaaaatttacatttcattgatattttctttttcatag
ATGAGGAGCTTTTCTCTGGAATGTATATAGATTTCATGGGGACAGATGCTGCTATTTTTC
GAAGTTTAACCAAGAGGAATGCGGTCAGAACTGATCAACATAATTCCAAATGGCTAAGTG

gtaagaaagcatttgatgcatttattttttagtatcgtgttaaactaacttatttaattc
tatcctaacaactagggaaaatggttaaaaactaaaatagcaggctattacatgaataat
ggtaattctgtaccctatgatttaaaatattcggggaaaataaacaattgaatagctcat
EXON 8  143 bp
cgacattccaaatgtggcatggtgtgtgaatgcaattactgcttttagaaatgtgcctgt
aaatgttgaattgtttttttctaccaaagatggggaaggcatctgcctgtggtctacttg
gatgacagaagatggattttcataatgaatatatacctagtcttttacctttttttctag
AACCTATGTTTGTAGATGCACATGTCATCCCAGATGGTACTGATCCAAATGATGCTAAGG
TGTACTTCTTCTTCAAAGAAAAACTGACTGACAATAACAGGAGCACGAAACAGATTCATT
CCATGATTGCTCGAATATGTCCT
gtaagtattaatgctgttccgatttgaagaaagaccaagaaattcaaattatggtttatc
tccgtgcttttattatcaaccattacaaataaataaaatattgagggaagcatttaatgt
aacatttattcatcatcattattatatttaatattcatcattttatattgaatatagtgt
EXON 9  115 bp
actattgtataaaatactataagtcataaatattcctctttgacaactgatgtgcagaag
tggttaacatatccattcttcagattttcatcctccaagcaactagagtacaagtcgaat
ttttaatgtgcttcaatatttacttaagcaatctgaattatgtttacaaaatggttttag
AATGACACTGGTGGACTGCGTAGCCTTGTCAACAAGTGGACCACTTTCTTAAAGGCGAGG
CTGGTGTGCTCGGTAACAGATGAAGACGGCCCAGAAACACACTTTGATGAATTAG
gtacatacatatgagattgaaaaatgcttctgaaagaaggcttgtaaagtttatatattt
aaataaggtctcaaaagaagatgtactttccatattttcagcataaataatatgctaatt
taaaataattatctagatactgttcataaattttcttaagtattttgtaatctgttacgc
EXON 10  70 bp
tgtattaatttaatttaatttagtgtttctatcattatttgtttccaaattaccataatg
gtacaggaatatctttttgcagagtacttttcagagttgaaattattttcttagggtaaa
tttttcaaaacaaagaagttaatatttagaaactttaaaagaatattttcctttttatag
AGGATGTGTTTCTGCTGGAAACTGATAACCCGAGGACAACACTAGTGTATGGCATTTTTA
CAACATCAAG
gtaattattcaacagttacattttatgagttaaacaataaacttcatggagtaacagtaa
ttattataaaagcattcttctctgcaacttttaattttacatgtcatttgggatgtaatc
cttccattttatttacttttgcctgattaccaaaatatattggagctaaactaatgcttt
EXON 11  145 bp
aatgctttatgtatcaataccttttttcaaagtttttcagcttttcacatgtgttcgata
acatttaacttttctatggtggattatattaactttttatcataaattttaccatatatt
ttttaaattgtattttaattttaaaaatttgaaaatgcctttttctgttttcttttttag
CTCAGTTTTCAAAGGATCAGCCGTGTGTGTGTATCATTTATCTGATATACAGACTGTGTT
TAATGGGCCTTTTGCCCACAAAGAAGGGCCCAATCATCAGCTGATTTCCTATCAGGGCAG
AATTCCATATCCTCGCCCTGGAACT
gtaagtatccagggaaaattctttgttatgatgctttataaaaactcatttaacaggtaa
tgaatatctgtggggttttttggggtttttttttgagacggagtctcactctgttgccca
gggtggaatgtagtggtgcaatctcagctcacctcaccctccgcctcccgggttcaagcg
EXON 12  223 bp
tgtactaatcatctacagatagtaaaacataatcatgttatttcttttcacttccatagg
tagcagatatacttaaaacaactggagcttctaagtgatttcaaaagtagagagtttttg
attattactagaacaagacaactattttattaacttggttctttaaaactttctttctag
TGTCCAGGAGGAGCATTTACACCCAATATGCGAACCACCAAGGAGTTCCCAGATGATGTT
GTCACTTTTATTCGGAACCATCCTCTCATGTACAATTCCATCTACCCAATCCACAAAAGG
CCTTTGATTGTTCGTATTGGCACTGACTACAAGTATACAAAGATAGCTGTGGATCGAGTG
AACGCTGCTGATGGGAGATACCATGTCCTGTTTCTCGGAACAG
gtaaatatttgagcccaagatatgctttaatgtgtagtaaaagaatgtactaaatatagg
tagtaggtaagggccatgatcttgaaactagaaaaactccaataattacgtctgtctagc
ccttagtgagatatttaatctctttttgcctcagtttcacatctgtaaaatgaagctaat
EXON 13  89 bp
tgtgtttcaatttttatgagatttggaatacattcagcacatggcagtggcttaatacat
acaatgttttttgattactaaatacttatgtaaataatggtccaagtcagtagtcctatg
tctaaatagctttcttttaaaaagtattgtaacatctcatttcttctttttttaatttag
ATCGGGGTACTGTGCAAAAAGTGGTTGTTCTTCCTACTAACAACTCTGTCAGTGGCGAGC
TCATTCTGGAGGAGCTGGAAGTCTTTAAG
gtttgaacatctcttctattaatctcagaacatgcatgatgagtggaattctttaatctt
acagccacttgggaggaaactatatttgataaaagatcaaataaatgaatgttatgaatt
tttgagggtaggaaaacaccagataaaataagaaatacagaacaaatatttttgcaaagt
EXON 14  42 bp
aggaagtgtactttatagacaagtatatgcaaatgtattttatataacaagtaattttaa
agtagatgtatatataaagaaaagtgatttcttcttgagatttaatagaaaaaaaatctg
aatgtaaaatccttttaagcaatatttgagcaactaacatgttgttttctaatattttag
AATCATGCTCCTATAACAACAATGAAAATTTCATCTAAAAAG
gtaaaaactaagctattttatgttctttgcttattgaaatgttttgttgttatgaaaaat
tatattttataacttctgaataattagttatcgtactaacaaaataaagagtactactta
aagtataccgcaaagtcacctttaattttgatgtagaacttacaaggtattagtgaaaga
EXON 15  158 bp
atattaatgtaggaaaattctatttattttggcttcatacccttctgtgctttgcttcat
gtttttaatcggttccaaaatgaatccaagggtttgtgggcatatattataatgtgttcc
tgctgaaagtcttcttttaacttccacatctgaaataaatcatcatcattcctttaatag
CAACAGTTGTATGTGAGTTCCAATGAAGGGGTTTCCCAGGTATCTCTGCACCGCTGCCAC
ATCTATGGTACAGCCTGTGCTGACTGCTGCCTGGCGCGGGACCCTTATTGCGCCTGGGAT
GGCCATTCCTGTTCCAGATTCTACCCAACTGGGAAACG
gtgagcactaaacactcggctcaacatccaaatgtaggacaccagacaatacagaagtgt
ttcacatctttagaattagttctattgctgtttccttaaatgacattaaaggtagaagct
atgtttaacaccacacatagtctttgaatgaagaaaatggtaatgtgttataacttgaga
EXON 16  68 bp
ccattattgataaattgtataagaaatgtgagatagctgcatcaatcagaactcttttta
aaaaattttatgaaagcttagcaataaaaagggtgcaaagtttaaaattacagtgtttta
agagtggtgtaattggcagtgataattctcagtcacttttatgtatttctgcacttgcag
GAGGAGCCGAAGACAAGATGTGAGACATGGAAACCCACTGACTCAATGCAGAGGATTTAA
TCTAAAAG
gtattaaaagtgagcaatggccaatctcagtgaacagtagcaatgctccgtatcacattt
cagtaaggggaaacattgtcatagattcaggcgtttcactttcaaaaatatttattataa
caattctgggtatttatatagggtaattaaaacttaaaggctttttgtatgtatactgag
EXON 17  131 bp
cgggtgaacaacgtatcctattttgcttgttaaatgattaccactgttttttgctggctg
cgatagttgttcacaattttgtataaaaataaacatgtatatagcatttctacaggagaa
tgtgctctaaattcagttgtgttctttctttctctctcgccttttatttttgcctgctag
CATACAGAAATGCAGCTGAAATTGTGCAGTATGGAGTAAAAAATAACACCACTTTTCTGG
AGTGTGCCCCCAAGTCTCCGCAGGCATCTATCAAGTGGCTGTTACAGAAAGACAAAGACA
GGAGGAAAGAG
gtgagtaaagcagcacagcagcaatccatcagggcttcggagagaacattaaatcactgt
ccctcggcgaggctcagatcaaaggaaaaaggaaaggcatatgatcatcttttacgtctt
tgggatgacaagtgccactttccttaaaatcctttgtccttaagaattgatggattaatt
EXON 18  2774 bp
ttaaaaaaaaaaaaggcaatggaactgaccaaaatttcatgtccactgagaaggatgcta
agtagtgctcaatacttttttcccaaatctgtgaaagttgagactattctgtgtatgttg
gtcataatctaaggaaatataatgttcagtttcagtaactttaatttgtctctcttttag
GTTAAGCTGAATGAACGAATAATAGCCACTTCACAGGGACTCCTGATCCGCTCTGTTCAG
GGTTCTGACCAAGGACTTTATCACTGCATTGCTACAGAAAATAGTTTCAAGCAGACCATA
GCCAAGATCAACTTCAAAGTTTTAGATTCAGAAATGGTGGCTGTTGTGACGGACAAATGG
TCCCCGTGGACCTGGGCCAGCTCTGTGAGGGCTTTACCCTTCCACCCGAAGGACATCATG
GGGGCATTCAGCCACTCAGAAATGCAGATGATTAACCAATACTGCAAAGACACTCGGCAG
CAACATCAGCAGGGAGATGAATCACAGAAAATGAGAGGGGACTATGGCAAGTTAAAGGCC
CTCATCAATAGTCGGAAAAGTAGAAACAGGAGGAATCAGTTGCCAGAGTCATAATATTTT
CTTATGTGGGTCTTATGCTTCCATTAACAAATGCTCTGTCTTCAATGATCAAATTTTGAG
CAAAGAAACTTGTGCTTTACCAAGGGGAATTACTGAAAAAGGTGATTACTCCTGAAGTGA
GTTTTACACGAACTGAAATGAGCATGCATTTTCTTGTATGATAGTGACTAGCACTAGACA
TGTCATGGTCCTCATGGTGCATATAAATATATTTAACTTAACCCAGATTTTATTTATATC
TTTATTCACCTTTTCTTCAAAATCGATATGGTGGCTGCAAAACTAGAATTGTTGCATCCC
TCAATTGAATGAGGGCCATATCCCTGTGGTATTCCTTTCCTGCTTTGGGGCTTTAGAATT
CTAATTGTCAGTGATTTTGTATATGAAAACAAGTTCCAAATCCACAGCTTTTACGTAGTA
AAAGTCATAAATGCATATGACAGAATGGCTATCAAAAGAAATAGAAAAGGAAGACGGCAT
TTAAAGTTGTATAAAAACACGAGTTATTCATAAAGAGAAAATGATGAGTTTTTATGGTTC
CAATGAAATATGTTGGGGTTTTTTTAAGATTGTAAAAATAATCAGTTACTGGTATCTGTC
ACTGACCTTTGTTTCCTTATTCAGGAAGATAAAAATCAGTAACCTACCCCATGAAGATAT
TTGGTGGGAGTTATATCAGTGAAGCAGTTTGGTTTATATTCTTATGTTATCACCTTCCAA
ACAAAAGCACTTACTTTTTTTGGAAGTTATTTAATTTATTTTAGACTCAAAGAATATAAT
CTTGCACTACTCAGTTATTACTGTTTGTTCTCTTATTCCCTAGTCTGTGTGGCAAATTAA
ACAATATAAGAAGGAAAAATTTGAAGTATTAGACTTCTAAATAAGGGGTGAAATCATCAG
AAAGAAAAATCAAAGTAGAAACTACTAATTTTTTAAGAGGAATTTATAACAAATATGGCT
AGTTTTCAACTTCAGTACTCAAATTCAATGATTCTTCCTTTTATTAAAACCAGTCTCAGA
TATCATACTGATTTTTAAGTCAACACTATATATTTTATGATCTTTTCAGTGTGATGGCAA
GGTGCTTGTTATGTCTAGAAAGTAAGAAAACAATATGAGGAGACATTCTGTCTTTCAAAA
GGTAATGGTACATACGTTCACTGGTCTCTAAGTGTAAAAGTAGTAAATTTTGTGATGAAT
AAAATAATTATCTCCTAATTGTATGTTAGAATAATTTTATTAGAATAATTTCATACTGAA
ATTATTTTCTCCAAATAAAAATTAGATGGAAAAATGTGAAAAAAATTATTCATGCTCTCA
TATATATTTTAAAAACACTACTTTTGCTTTTTTATTTACCTTTTAAGACATTTTCATGCT
TCCAGGTAAAAACAGATATTGTACCATGTACCTAATCCAAATATCATATAAACATTTTAT
TTATAGTTAATAATCTATGATGAAGGTAATTAAAGTAGATTATGGCCTTTTTAAGTATTG
CAGTCTAAAACTTCAAAAACTAAAATCATTGTCAAAATTAATATGATTATTAATCAGAAT
ATCAGAATATGATTCACTATTTAAACTATGATAAATTATGATAATATATGAGGAGGCCTC
GCTATAGCAAAAATAGTTAAAATGCTGACATAACACCAAACTTCATTTTTTAAAAAATCT
GTTGTTCCAAATGTGTATAATTTTAAAGTAATTTCTAAAGCAGTTTATTATAATGGTTTG
CCTGCTTAAAAGGTATAATTAAACTTCTTTTCTCTTCTACATTGACACACAGAAATGTGT
CAATGTAAAGCCAAAACCATCTTCTGTGTTTATGGCCAATCTATTCTCAAAGTTAAAAGT
AAAATTGTTTCAGAGTCACAGTTCCCTTTATTTCACATAAGCCCAAACTGATAGACAGTA
ACGGTGTTTAGTTTTATACTATATTTGTGCTATTTAATTCTTTCTATTTTCACAATTATT
AAATTGTGTACACTTTCATTACTTTTAAAAATGTAGAAATTCTTCATGAACATAACTCTG
CTGAATGTAAAAGAAAATTTTTTTTCAAAAATGCTGTTAATGTATACTACTGGTGGTTGA
TTGGTTTTATTTTATGTAGCTTGACAATTCAGTGACTTAATATCTATTCCATTTGTATTG
TACATAAAATTTTCTAGAAATACACTTTTTTCCAAAGTGTAAGTTTGTGAATAGATTTTA
GCATGATGAAACTGTCATAATGGTGAATGTTCAATCTGTGTAAGAAAACAAACTAAATGT
AGTTGTCACACTAAAATTTAATTGGATATTGATGAAATCATTGGCCTGGCAAAATAAAAC
ATGTTGAATTCCCC
agttatgtttctagcttttatttttaacgtagggttaacttacttgttagcatgatagaa
tctactgaattcatatcatttttaaagattcctttatccattttttgtgaaggtaatgca
tcactatttcaaaatttaaattgtggaaaaatgcacatataaagctctcccagtaccaat