Gene PON3 Variant 1
DNA : 36.39 KbNT_079595
mRNA : 1075 bp NM_000940
CDS : 1065 bp NP_000931
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  74 bp
ggcggcggggctcggcgggactcgtcagcgccctgctgcggcacccgggccgctcaggta
agtaggaggcgtgtgcgggcggggccgagcgggccccaatccgtacgcgaggcaggaacc
gcccgccgcgcccccgagagctctcggcgccgcgcagtcgccgctgggcaccccgagacc
ATGGGGAAGCTCGTGGCGCTGGTCCTGCTGGGGGTCGGCCTGTCCTTAGTCGGGGAGATG
TTCCTGGCGTTTAG
gtgagtggcatcttgacagggcgtcttcgactctctttctctcctcttccaagtgaggtc
aggggctgcctggcgcccccttcctagcgggtaggaaagagcagctttggaacctcactc
ctccatctcacccagcaaaccgccccttgagactcgcttatggggaaagtgagctacttg
EXON 2  71 bp
acccacataatgtctacattatgtaaataaacatgaaaggaagtacctacttacttgtta
tgtcattcataaattatgataaagatagttaaccaacacgaagatgattgaagtccacat
ttaaacatacattttgaatgctgtgccttgacttccagggttgggttttatcttctacag
AGAAAGGGTGAATGCCTCTCGAGAAGTGGAGCCAGTAGAACCTGAAAACTGCCACCTTAT
TGAGGAACTTG
gtatgtatgtgacagtaccaagaggagccagcacagcttcttggtcgtcatccacctgac
tgagccctaccagctcatttaattacctgtcactacttaagccctcccagtgggacatct
gccccgtccactctgccccatgcaaggtcttcaggggtgtactaaatgacattctttgtg
EXON 3  56 bp
ttactatagagtagcatgcctgtgagattctccaaagttaatatggtttcccaagtaaat
ggttgaacaagtcaacaatttccaaaagaagtttccaaaagatatttgtagtttggactg
tgagacgtattttttaagccttcatatatgcatttttctgattctacccttcttttgcag
AAAGTGGCTCTGAAGATATTGATATACTTCCTAGTGGGCTGGCTTTTATCTCCAGT
gtgagtattttccatgctgctctcatgctcacatcaatagctgtatagacagtgcattaa
tgttgtcctctggagctgccagatggatccctatgctctcatcccacctccgggtaaacc
agtcaactaaaaaagccaaaacagaattttggagggctaattagaacaccacaggaatgc
EXON 4  166 bp
atgacatcagtaacaccccagatcagatcatggaaacagctgacagagtgaaaaagccca
gtaatctaaatgaaatttagaactttgaacatttttatttggctttgagattttaaattc
cttatgaaaatattgttttgatatgtatatgtgtgcacacttgttctttatttttaaaag
GGATTAAAATATCCAGGCATGCCAAACTTTGCGCCAGATGAACCAGGAAAAATCTTCTTG
ATGGATCTGAATGAACAAAACCCAAGGGCACAAGCACTAGAAATCAGTGGTGGATTTGAC
AAAGAATTATTTAATCCACATGGGATCAGTATTTTCATCGACAAAG
gtaaaacctgtatgtttagggataagggggaaatgagggaaatagaaaccatttatctcc
agcccctcaatatttatgtaacaggaagagagaagatgctattttaccatacagatgtgt
ttttttaaaatgataaataggtataaaaccttgtaaacattgcattaaagaaggaacact
EXON 5  127 bp
caatttcctcaactaaatctggattctggcatttgtctgacttacctatcatgtagactg
tgagggtcaaatgcaagatgtaagaagaaaacttttggaagtgaccaagttttaaaacaa
gtctaatattagttgtgataggggtaactttcttggaaattatcccttttttccatgtag
ACAATACTGTGTATCTTTATGTTGTGAATCATCCCCACATGAAGTCCACTGTGGAGATAT
TTAAATTTGAGGAACAACAACGTTCTCTGGTATACCTGAAAACTATAAAACATGAACTTC
TCAAAAG
gtatggaatgaaagtattgtgcggttctatttactttgcacctctgctgtgtgctttgta
ttttttggttcagcaggctttcttaaacttttgttttgaaattgttttgatttttttcta
aagctttctaatgattcccatggtgactcttcccagcgcctcactagaaattgccatgtt
EXON 6  201 bp
aacccatcagggcaatgcagaatcatgattttctgtggaattccttaatccatactagtt
catgtatcctttttcaaattgatgaacgtattagtctatgtagagatgagtgattttgac
aaggataaaggatatttaaatacctcatgggtctctttttccacctccctttcactttag
TGTGAATGACATTGTGGTTCTTGGACCAGAACAGTTCTATGCCACCAGAGACCACTATTT
TACCAACTCCCTCCTGTCATTTTTTGAGATGATCTTGGATCTTCGCTGGACTTATGTTCT
TTTCTACAGCCCAAGGGAGGTTAAAGTGGTGGCCAAAGGATTTTGTAGTGCCAATGGGAT
CACAGTCTCAGCAGACCAGAA
gtaagctcttttgtgtatttttctatcctttgcccttgacattttcgtggactcctttcc
ttacgaggaagttacttccttacttaggcttacgtagtgaatatatgtgtggagggatca
gttgtggccagggttcacactaaatctgtcatcctaagcaatccatttgtttccttggac
EXON 7  82 bp
gtttaaagcacttcaagaatattaaaaatactaccccattatcttcttttactgtggttt
agaaaaggattgcagtggtactttcaaggagtgtgcatttttatacctcttctccaaaat
aaaagtgagtgttgtctctcattaccacttgcttaagtgtaaatgtcatttacttcaaag
GTATGTCTATGTAGCTGATGTAGCAGCTAAGAACATTCACATAATGGAAAAACATGATAA
CTGGGATTTAACTCAACTGAAG
gtaagagtaccctgtctggcccacacaatctgacttcttaccttagtcccatacttgacc
caggaatgtgccccttgaatgaggaaaacatggctatttgagagcaatgccagtgagatt
atgcatgcgtttctaaaatacagaagcaaagccccctaaaaacaccaactttaggtgcca
EXON 8  129 bp
atggctatttgagagcaatgccagtgagattatgcatgcgtttctaaaatacagaagcaa
agccccctaaaaacaccaactttaggtgccagaagaagctgtaggggttgtggggatgaa
tagggaagaaagcgaggaatcattgagacaatgtcttcactactccctctttgttgtaag
GTGATACAGTTGGGCACCTTAGTGGATAACCTGACTGTCGATCCTGCCACAGGAGACATT
TTGGCAGGATGCCATCCTAATCCTATGAAGCTACTGAACTATAACCCTGAGGACCCTCCA
GGATCAGAA
gtaagttcctatacctctctgagctcacaggcaaagctgcaagaacaaatttgttggggt
gacttggaagaatttaagccagtcacatttggtgttatagaactaaagaaattttacgta
tgagaaaagtaaagtttttgacaggtagggagataaggttcgttaactcttttaggccac
EXON 9  169 bp
ttggtgcatagatatctatgacattagtactttcatcagaagaagaacaatttattgaag
atatacagattttagcttctgatttctgaaaaatagatttatcctagaatgtttgggaag
gacatcatgaaacaggtgtttactcacataatatactaataaacgatcttttctcgacag
GTACTTCGCATCCAGAATGTTTTGTCTGAGAAGCCCAGGGTGAGCACCGTGTATGCCAAC
AATGGCTCTGTGCTTCAGGGCACCTCTGTGGCTTCTGTGTACCATGGGAAAATTCTCATA
GGCACCGTATTTCACAAAACTCTGTACTGTGAGCTCTAGACTCTAGATA
gtaaaaaaaaaaaaaaaaagtctacatattttgtaaaagtaaactgataattgtatgata
agtggcactgtaagtaaatagcaaacaccaaccagtgagtgtggcttttcttatggatag
aagtaaaggagcagacagagattccttgatagccatcaaattgcaagtcaggttaatgac