Gene PMS2 Variant 1
DNA : 35.80 KbNT_079592
mRNA : 2771 bp NM_000535
CDS : 2589 bp NP_000526
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  47 bp
ggcccaggctctttgacgtcacgaagtcgacctttgacagagccaataggcgaaaaggag
agacgggaagtatttttgccgccccgcccggaaagggtggagcacaacgtcgaaagcagc
caatgggagttcaggaggcggagcgcctgtgggagccctggagggaactttcccagtccc
CGAGGCGGATCGGGTGTTGCATCCATGGAGCGAGCTGAGAGCTCGAG
gtgagcggggctcgcagtcttccggtgtcccctctcgcgcgccctctttgagacccacgg
cattccaacctccctggaaatggggggaacatggccgaggcgcgtggcgaggcagccccc
tggaggccccggagtggcgacctcagtgttgcagcgatctcgtgccccttgggtgcgcct
EXON 2  140 bp
tttaaggattgtaaaacagtgtttctatttctggatataataaatgtatttgctaatata
ataaatgaatagattagacccataaattatttacagtgttgagtcatttcccacagttaa
aatcaggatgaaaatatatagctgaatacttgatttgtttcttgtaactgatttctctag
TACAGAACCTGCTAAGGCCATCAAACCTATTGATCGGAAGTCAGTCCATCAGATTTGCTC
TGGGCAGGTGGTACTGAGTCTAAGCACTGCGGTAAAGGAGTTAGTAGAAAACAGTCTGGA
TGCTGGTGCCACTAATATTG
gtaagtttgggagagttttaagccacaagaaatgatctgtgaatgttgttgtagttaaga
aacatttgttattgaaataagactatcaagtgttgatgtagtaataaattattattttta
agttgaagttagcacctattatgtgcctagtacttagctaggtagtaataataataacag
EXON 3  87 bp
gggctagtaaatagccagaaaggactttataacaatgaaatatacaaaatgacactagta
tgtttaactaaaggtatagttatgactcttaaatttgcatatgttataaataatgtcaat
ataaaaactgatagcatgggtccgtttttaataaatatgtaaatattttaaactttctag
ATCTAAAGCTTAAGGACTATGGAGTGGATCTTATTGAAGTTTCAGACAATGGATGTGGGG
TAGAAGAAGAAAACTTCGAAGGCTTAA
gtaagttgactttttctaatcctattataaaataattgggtcacatgtctcagaattttg
agtaacactgtcttgggaaatgcaaaaacagttttttaaagccagttactagatatcatg
tatattttgttgttatagcacttgagatatcttagtccttactttacactctctttcagc
EXON 4  103 bp
agtaagttgactttttctaatcctattataaaataattgggtcacatgtctcagaatttt
gagtaacactgtcttgggaaatgcaaaaacagttttttaaagccagttactagatatcat
gtatattttgttgttatagcacttgagatatcttagtccttactttacactctctttcag
CTCTGAAACATCACACATCTAAGATTCAAGAGTTTGCCGACCTAACTCAGGTTGAAACTT
TTGGCTTTCGGGGGGAAGCTCTGAGCTCACTTTGTGCACTGAG
gtgatacaatatttttatccactcacttgaccccttagagaaacctctctgaaaattaat
tggaatcattattattttcagttttctatctcaacatctcaacttctagcttctgaattc
tgttttgtctcgctgccaatctaagtcatagtacttctgaaatgtgagcaataaatgaat
EXON 5  184 bp
tttagatgccaaaccttagattttatgatgactcctcaaccatttagatcttgattatct
cagagggatcgtcagctttttaagaaaattttgagagaaaagcaagtgaagaaaagagta
gtcagtgcccaacatcatgggtctctcactgaacacaccatgcctggtattctctcacag
CGATGTCACCATTTCTACCTGCCACGCATCGGCGAAGGTTGGAACTCGACTGATGTTTGA
TCACAATGGGAAAATTATCCAGAAAACCCCCTACCCCCGCCCCAGAGGGACCACAGTCAG
CGTGCAGCAGTTATTTTCCACACTACCTGTGCGCCATAAGGAATTTCAAAGGAATATTAA
GAAG
gtacagtaaattaatcctggttttcaagagtattggttaatgcacatgagcaaaagattt
actaaagatgtttattcttcagttgattctcttcccataaattattgagaaatgctttat
ttgcatttctcattaaagatttaacattaaagacttaactttaggatgatttactttttt
EXON 6  168 bp
gctctgcgttcctttctgtagaatataggaagacacctctttacagatcattctgtcaac
agtgcttcccttgatttgtgcgatgatgtgagaaccttgcgttggatgttgtaacttgag
ctgtgtaattcctataatattaaagtaatgtagaatattgtgtttgtgttttttaaacag
GAGTATGCCAAAATGGTCCAGGTCTTACATGCATACTGTATCATTTCAGCAGGCATCCGT
GTAAGTTGCACCAATCAGCTTGGACAAGGAAAACGACAGCCTGTGGTATGCACAGGTGGA
AGCCCCAGCATAAAGGAAAATATCGGCTCTGTGTTTGGGCAGAAGCAG
gtagtgatggccggttacttcaacgcctcttattgctctagtgattatagcgggtttcca
ttgtcccttccagtagaatggagaataaaatcttagaattgattttttttttttttttga
gagggagtctcgcactgctgcccaggctggagtgcagtggtgttgtcttggctcactgca
EXON 7  98 bp
cattgtactccagcctgggcaatagagggagaccctgtctcaaaaaacaaaacaaaacaa
aagattcttttaattttttttgcgcttgtaatgtcaatagcttgactaagaaagaaaaca
gattaagtccactctgtctttattaggaagtaactgtgaatttttttttttttttttcag
TTGCAAAGCCTCATTCCTTTTGTTCAGCTGCCCCCTAGTGACTCCGTGTGTGAAGAGTAC
GGTTTGAGCTGTTCCGATGCTCTGCATAATCTTTTTTA
gtaagtagattgctggcaagagaactacaattgaacattttatcctgagagctttttttt
taaagatagtgattctaaggctaatagtttcgtgtctttttttttttttcttgagacgga
gtcttgctttgttgcccaggctggagtgcaatggtgctatcttggctcactgcaacctct
EXON 8  100 bp
ttggttctttgatgactcatcaagatttggagcacagatacccgtgaactgcaatagtga
tccttatcagcatgtcacctggtgttttgttttcatttcactttaagaatgtgccatgtg
atcgtatttctaatccctttcactctggaatcctgcccttaccatattaatgttgaatag
CATCTCAGGTTTCATTTCACAATGCACGCATGGAGTTGGAAGGAGTTCAACAGACAGACA
GTTTTTCTTTATCAACCGGCGGCCTTGTGACCCAGCAAAG
gtatttaaaatttttttgtgttagtttgttctttatgcctttgacttttaattgataact
tttttctgataataggcagtttacgtggagctcgggactttgagaaacatggctttaaca
ttatcttattttgtgcatttacagaagtctaccgcagatggcccccagcttcagatgttt
EXON 9  85 bp
catgattgctccactgcactccaggctgtgacaaggcgagaccttgactcaaaaaaaaaa
aaaacaaaaaagtatccccttctaagaacatgctggttggttagaatagaatgttgttag
aatgcggggggctgggaacatttgtcatttattcttttctactccttgtattttgtgcag
GTCTGCAGACTCGTGAATGAGGTCTACCACATGTATAATCGACACCAGTATCCATTTGTT
GTTCTTAACATTTCTGTTGATTCAG
gtaagttccattggcatttcagtacaactagtgactaatgcctcaaagaataaaatgaaa
ttctacagctctgctatgactggaatgagataacaatttatggtcatgtaagttttttgt
ttttgtttttttttgagacggggtcttgctctgtcacccaggctggagtgtggtggcgtg
EXON 10  156 bp
ttcggaggctgaggcagggagaatcacttgaacccaggaggcggaggttgcagtgagctg
agatcgcgccactgcactccagcctaggcgacagagtgagacgctgtctgaaaataataa
ttaataaataaaataaaagtgaatttaaacataataaatatgttttcttttttgccttag
AATGCGTTGATATCAATGTTACTCCAGATAAAAGGCAAATTTTGCTACAAGAGGAAAAGC
TTTTGTTGGCAGTTTTAAAGACCTCTTTGATAGGAATGTTTGATAGTGATGTCAACAAGC
TAAATGTCAGTCAGCAGCCACTGCTGGATGTTGAAG
gtaagaaaaatacagtgtacaaacagcttctaaagcttttagctaatgtgtttccttatt
ttttccaagtaaacttttttttgacatgaaaacaaagtctcttatattattttatcattt
ttaattcttttttgagacagggacttgctctgtcacccaggctggactgcagtggtgcca
EXON 11  867 bp
taacaggcgtaagccaccacacctggcccatattatagttttattttgaacattgaactg
tgttcatctgtgtaattagcatgtggatctcctcttttgtgaagtatctgttcacataag
cacgtcctctcaccatttcaggatagtccctgaccctcttctccgtccacgtttgcttag
GTAACTTAATAAAAATGCATGCAGCGGATTTGGAAAAGCCCATGGTAGAAAAGCAGGATC
AATCCCCTTCATTAAGGACTGGAGAAGAAAAAAAAGACGTGTCCATTTCCAGACTGCGAG
AGGCCTTTTCTCTTCGTCACACAACAGAGAACAAGCCTCACAGCCCAAAGACTCCAGAAC
CAAGAAGGAGCCCTCTAGGACAGAAAAGGGGTATGCTGTCTTCTAGCACTTCAGGTGCCA
TCTCTGACAAAGGCGTCCTGAGACCTCAGAAAGAGGCAGTGAGTTCCAGTCACGGACCCA
GTGACCCTACGGACAGAGCGGAGGTGGAGAAGGACTCGGGGCACGGCAGCACTTCCGTGG
ATTCTGAGGGGTTCAGCATCCCAGACACGGGCAGTCACTGCAGCAGCGAGTATGCGGCCA
GCTCCCCAGGGGACAGGGGCTCGCAGGAACATGTGGACTCTCAGGAGAAAGCGCCTAAAA
CTGACGACTCTTTTTCAGATGTGGACTGCCATTCAAACCAGGAAGATACCGGATGTAAAT
TTCGAGTTTTGCCTCAGCCAACTAATCTCGCAACCCCAAACACAAAGCGTTTTAAAAAAG
AAGAAATTCTTTCCAGTTCTGACATTTGTCAAAAGTTAGTAAATACTCAGGACATGTCAG
CCTCTCAGGTTGATGTAGCTGTGAAAATTAATAAGAAAGTTGTGCCCCTGGACTTTTCTA
TGAGTTCTTTAGCTAAACGAATAAAGCAGTTACATCATGAAGCACAGCAAAGTGAAGGGG
AACAGAATTACAGGAAGTTTAGGGCAAAGATTTGTCCTGGAGAAAATCAAGCAGCCGAAG
ATGAACTAAGAAAAGAGATAAGGTAAA
gttttaattttttactttttctctttttatctaaaatttttatttttattttttattttt
ttgagacagagtcttgctctgttgcgcaggctggaatgcagtggcatgatcttggctcac
tgcagcctccacctcccgggttcaagcgtttctcctgcctcagcctcctgagtagctggg
EXON 12  164 bp
gcactgtagcctgggtgacagaacgagactctgtttcaaaaaaaaagaaagcgggatggc
tagggactttattttgtttttgtattgtttgactttttttttattacagtgttctataac
ataatcagaaaaataatcttgtaaaatgtctgataattaacattttctacctgcagtaaa
ACGATGTTTGCAGAAATGGAAATCATTGGTCAGTTTAACCTGGGATTTATAATAACCAAA
CTGAATGAGGATATCTTCATAGTGGACCAGCATGCCACGGACGAGAAGTATAACTTCGAG
ATGCTGCAGCAGCACACCGTGCTCCAGGGGCAGAGGCTCATAGC
gtgagtgtgtttagtgttcattcccagactccccctcaaattgaagatctaatagaggcc
aaggcaggaggatcacaagaggccaggagtttgagaccagcccggacaacacagcaagac
cttgtatctactttaaaaaagaagagatctaggaaggaggggtgtaaaaaataaaaaata
EXON 13  101 bp
agagaaaattaaaaggaacttctcaggaagttttgtgacacttagctgagtagtgttgtt
atttgtgttgttattttgacatgaattcaaaatacagtattgttgttttcatttcatttc
tgctgtaaagctaaatgtttgacttcaggatatggtttgaatcatttttgtgtttttcag
ACCTCAGACTCTCAACTTAACTGCTGTTAATGAAGCTGTTCTGATAGAAAATCTGGAAAT
ATTTAGAAAGAATGGCTTTGATTTTGTTATCGATGAAAATG
gtaagttattaattagaactatagcggctgggtgtggtggctcacgtctgtaatcccagc
actctgggaggccaaggcgggcagatcgcctgaggtcaggagtttgagaccagcctggct
aacatggtgaaaccccatctctactgaaaatacaaaaagtagccgggcgtggtggcgggt
EXON 14  170 bp
ccatgttagccaggatggtctgtatctcctgacctcatgatccgctggcctcagcctccc
aaagtgcagggattacaggcgtgagccaccacgcccggcctcagatgttcatcctaagta
gctttcaagtgaaacgtgtttgtcaagtcatggatttttctcaaaattgtattcttttag
CTCCAGTCACTGAAAGGGCTAAACTGATTTCCTTGCCAACTAGTAAAAACTGGACCTTCG
GACCCCAGGACGTCGATGAACTGATCTTCATGCTGAGCGACAGCCCTGGGGTCATGTGCC
GGCCTTCCCGAGTCAAGCAGATGTTTGCCTCCAGAGCCTGCCGGAAGTCG
gtaagtaaagaaagcctggctgtcagctcagctgctcaagcttgcagtcgaggaaggtct
cagcccagctcctgatttggtcaaggttgtaaacgcctttgtgattgccaggggtcattt
tacacagagagctacgtgcagcgtcgtagctgagcatctgtgtcgtctgcgttctctgtg
EXON 15  301 bp
cagaagggtggagggctgagatctagaacctaggcttctctgggggaaggtttttcaggg
aaggtagtttttgagctgtaatcttgtccagccttattttagagaagaatgcttctgaag
agctgccattctgacgtcaaaaaactactaaaacgttgaaccattgtgtctcacactcag
GTGATGATTGGGACTGCTCTTAACACAAGCGAGATGAAGAAACTGATCACCCACATGGGG
GAGATGGACCACCCCTGGAACTGTCCCCATGGAAGGCCAACCATGAGACACATCGCCAAC
CTGGGTGTCATTTCTCAGAACTGACCGTAGTCACTGTATGGAATAATTGGTTTTATCGCA
GATTTTTATGTTTTGAAAGACAGAGTCTTCACTAACCTTTTTTGTTTTAAAATGAACCTG
CTACTTAAAAAAAATACACATCACACCCATTTAAAAGTGATCTTGAGAACCTTTTCAAAC
C
agatggagcattgcttgcaaattttttttctctatgtttgcatgcgctcgtgtgtgtgtg
tccaggcaagaacacattttataaaaataagaacacttgggctgggcatggtggctcatg
cctgtgatcgcagcactttgggaggccgaggccggcggatcacctgagatcagaagttcg