Gene PMPCB Variant 1
DNA : 15.11 KbNT_079596
mRNA : 1766 bp NM_004279
CDS : 1470 bp NP_004270
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  107 bp
tgcagactccccaattcatttggtaaagaccgctcagcatcatggtcgggccctgattgc
tttcacaaccgcttcgaggagtgtcattcccatcacggccacaaggtggagcccacctcc
ctgctctgggacctcaggtcgcgaccccggaagcacatccttcatcctctaccttccttc
TAGCAGAAATGGCGGCTGCGGCGGCTCGAGTGGTGTTGTCATCCGCGGCGCGGCGGCGGC
TCTGGGGTTTCAGCGAGAGTCTTCTAATCCGAGGCGCTGCGGGACGG
gtgagcttccctccaggccggtcctgtcctcgagatctcgccagacccggcgcagcgcac
ctgagagtcggcgccacagatccgaacagtgggtcgggcagggcctcctcgacccggacc
cgccgggcgccaggcggcctggggctgctgaactggccgggggtgactggcttgtggcca
EXON 2  141 bp
cagtggctggtgacagatgtttctaggccaggcagagatctcagtggaaccaaaattcaa
gaagaaagattcttttatagagacagcctatttaaaatagatttggttttaaaagcaaca
tttaatatcagattagtaatgtgttttgctttgtctcttccacttcctacccccaaccag
TCATTATATTTTGGAGAGAACAGATTAAGAAGTACACAGGCTGCTACCCAAGTTGTTCTG
AATGTTCCTGAAACAAGAGTAACATGTTTAGAAAGTGGACTCAGAGTAGCTTCGGAAGAC
TCTGGGCTCTCAACATGCACA
gtaagtgactcaggcaaccttctctaagtgacccttcatttagcgtagcaaattgttgat
tttaatctttagctttttcgttggctggtggttcaaaaagggtgacagttattttgcctt
gacagatttccatgagttgtgaaccttttcttccagtggtacttagttacagggtgcata
EXON 3  87 bp
gtatcctgatcgaaatttttaaatctcatagttcacaggaatgaactatcaattcactca
ggtcaagaaaatcttagtgttaagaccagaaagcatttgtcagaaaaaggaaggagactg
ttccccccaacctcaaataaataaaatgaatttatttaattgttctttgattgcattaag
GTTGGACTCTGGATTGATGCTGGAAGTAGATACGAAAATGAGAAGAACAATGGAACAGCA
CACTTTCTGGAGCATATGGCTTTCAAG
gcaagttgtaagactttacaaaaatgcactctctttaagagataataagcacaaagtctc
attctttagaggcagggagagctctttcagtagtataacatgttttatgtttatttttcc
aggacagtatctaaaataagtagtgataattgctttgtaaagctgaaatgaaaactttct
EXON 4  130 bp
tcagcttctcaaagtgctggggttacaggtgtgagccatcgtaccatacctgatgtactt
tagaaaccaaatttgaccctgcatgaaactaacttatgtcctccatattcattatctgaa
gtagaatagatgaagtataaagggagtttgcataatttgtttttcctcttttatttcaag
GGCACCAAGAAGAGATCCCAGTTAGATCTGGAACTTGAGATTGAAAATATGGGTGCTCAT
CTCAATGCCTATACCTCCAGAGAGCAGACTGTATACTATGCCAAAGCATTCTCTAAAGAC
TTGCCAAGAG
gtactgttattatttatacagcagataatgtaattttcatgagaatcaggaattatttag
tactatttttattatgtctgttgtaaaagagtaagttccagaaatgtgaaaaagcgaaac
tgaattctgggtgagggtacagctgatcttattttttttctaaatatgacaaatagtaaa
EXON 5  199 bp
ggggtttatatgttaaattttaattttgtcctgttaagtatatctgatgtttttctccta
ggctaatcatttagtattgagtgatgggtcagtgtcatgatttctgattttggtttaata
gattttaatagtgaaagttaagattgctggcacgttttcttatattttattttcaattag
CTGTAGAAATTCTTGCTGATATAATACAAAACAGCACATTGGGAGAAGCAGAGATTGAAC
GTGAGCGTGGAGTAATCCTTAGAGAGATGCAGGAAGTTGAAACCAATTTACAAGAAGTTG
TTTTTGATTATCTTCATGCCACAGCTTATCAAAATACTGCACTTGGACGGACAATTTTGG
GACCAACTGAAAATATCAA
gtaggtataacagaatttcttggtgtataagggaatttatgaatgttgaaaataaacatt
tacaaattttcaaaaagtatgtttcagaaagtaattttccccctggtaatctaagtgaaa
ctgtagttagctacattttagtcccacctagctcccaagcacgtgagttcataggtactt
EXON 6  80 bp
ccagtaatggtgtattttttctttgatgtaaaaaaggtgaagttctttgatgtgttgcct
gtatcctatttctgactgcattttaggatacagttatggtccaatttgatttcaggtata
ttatgtgaagatctgttttttttttggtttcctttaaaaattgttttacttcatttacag
ATCTATAAGTCGTAAGGACTTAGTGGATTATATAACCACACATTATAAGGGGCCAAGAAT
AGTGCTTGCTGCTGCTGGAG
gttagtcaatttaaatttctacaaatgttttaaacacagttgttggagtggtatgcttat
tagtttgatcctgttgggagataccctaagaattttcatttacatagcaaataactgata
gtgtgtaaggggaatgtggagcactggaatcagaatttccctctattttttttaaagtag
EXON 7  113 bp
tgcaacctcaagctttgcaacaccaaggaaataggtgtgctatgtgagcttactcttaaa
taatggcttttagtgagtgtagatagttcatgtgtaatgtacatcacattataccaccta
gggtttattgtaaactatattgctgctagatacatgtgaaaatattttctttcaatttag
GTGTTTCCCATGATGAATTGCTTGACTTAGCAAAGTTTCATTTCGGTGACTCTTTATGCA
CACACAAAGGAGAAATACCAGCTCTGCCTCCCTGCAAATTCACAGGAAGTGAG
gtagggcaagccttccagctagtatttagccttttggattccttgtgttgtatttacaca
taagtaaacaaaatgtgcatatttccagtaggaaaagaatggaataataggaaaagggaa
gaggatgtactcatttgcttacattccttcctcttccgtattctttaaccacctattttt
EXON 8  144 bp
cttaattcttctagattaaactcaacaatgtaatgaggcctgatagttaaaaaatcaaaa
tagagtcctggtgtgcattttaactttgcagttaatgggactggtgattttttccttgtt
aataagcatgttatataatgttaatcttaactagaggtcctcctgctttatcttaactag
ATTCGTGTGAGGGATGACAAGATGCCTTTGGCGCACCTTGCAATAGCTGTTGAAGCTGTT
GGTTGGGCACATCCAGATACAATCTGTCTCATGGTTGCAAACACGCTGATTGGCAACTGG
GATCGCTCTTTTGGGGGAGGAATG
gtaagtgattttaaaagaaattttccataacagatggaagattatcatgttttcttaaat
ataagttctttgtaagaatccttttttaaagtggcagaatagagtcttgtactgtgaatt
ctgacttaaaaatataaactgatcctggattgcatgtgggccagaaaaagtttctttttt
EXON 9  161 bp
taagtgagataataaacacaattcttagtcatactgaattttaactctactactgagatg
ttgaataaaactaggaaacagcctctaaggatattcactattttccacacactccatttt
tctttctgtattttggacatgtataattaaaattctcttggaatttttttttccttgcag
AATTTATCTAGCAAGCTGGCCCAGCTCACTTGTCATGGCAATCTTTGCCATAGCTTTCAG
TCTTTCAACACTTCCTACACAGATACAGGATTATGGGGACTGTATATGGTTTGTGAATCA
TCCACTGTTGCAGACATGCTACATGTTGTTCAAAAAGAATG
gtgagaaaaatagctttaagtaatttaaattttgcctttaattcgttttaaactagtttt
ttatttatactttatggtgatttatggtaattttaccttttaattaagagacctagataa
acagtagttgccatgttttcaaaggttgcagttggtttttcctaagtctcaagatgtgaa
EXON 10  86 bp
tatgtatcatttttgagaaattaatactggggaaaataatcattttagcttttgcttagc
attggaattaaattgtaatcacctgtatgttttgtgtagaagatggcatcatcattctta
ggtcattaactcatgaaatacaacattttccaactactactgtttttccacgttttttag
GATGCGACTCTGTACAAGTGTCACAGAAAGTGAGGTTGCACGAGCCAGAAATCTTCTGAA
AACAAACATGTTGTTGCAGCTTGATG
gtaaaaataaagatataggttctgttttcatatggttgatctgtattccaatagttaatt
tttccttctctttaaacaggttcaactccaatttgtgaagatattggtaggcaaatgtta
tgctataatagaaggattcccatccctgagcttgaagcaagaattgatgtaagtagtcct
EXON 11  89 bp
ttccacgttttttaggatgcgactctgtacaagtgtcacagaaagtgaggttgcacgagc
cagaaatcttctgaaaacaaacatgttgttgcagcttgatggtaaaaataaagatatagg
ttctgttttcatatggttgatctgtattccaatagttaatttttccttctctttaaacag
GTTCAACTCCAATTTGTGAAGATATTGGTAGGCAAATGTTATGCTATAATAGAAGGATTC
CCATCCCTGAGCTTGAAGCAAGAATTGAT
gtaagtagtcctgagttactattgggtcatgtgtaaaaagatccttgttacaaaagctga
gaatatgtatctttcatcttgctttagttttaaaaagttccaggtatagactttgttttt
actacaaacagctgaatgacagtgtcttccatatttcaggctgtgaatgctgagacaatt
EXON 12  76 bp
gagcttgaagcaagaattgatgtaagtagtcctgagttactattgggtcatgtgtaaaaa
gatccttgttacaaaagctgagaatatgtatctttcatcttgctttagttttaaaaagtt
ccaggtatagactttgtttttactacaaacagctgaatgacagtgtcttccatatttcag
GCTGTGAATGCTGAGACAATTCGAGAAGTATGTACCAAATACATTTATAATAGGAGTCCA
GCTATTGCTGCTGTTG
gtaagcctggcttcttttcttctatgcaaaaagttggccaagtacttttaattaactctt
ctttttaatccttaggtcccattaagcaactaccagattttaaacagatacgcagtaaca
tgtgttggcttcgtgattaaaatgctcctaatcaagattgtttgaacacatgtatttata
EXON 13  353 bp
gctgaatgacagtgtcttccatatttcaggctgtgaatgctgagacaattcgagaagtat
gtaccaaatacatttataataggagtccagctattgctgctgttggtaagcctggcttct
tttcttctatgcaaaaagttggccaagtacttttaattaactcttctttttaatccttag
GTCCCATTAAGCAACTACCAGATTTTAAACAGATACGCAGTAACATGTGTTGGCTTCGTG
ATTAAAATGCTCCTAATCAAGATTGTTTGAACACATGTATTTATAAAACAGAGCTAGAGA
AAAATAAAAATGAACATGTATATACATTTGGAAATTTGAATTAAATACTGTATCATACTT
TCAAAGGATAAAAAGACTACCCCTCTGAAGGTTGTTTTGTATTAATGGTCAGTCTTTGTT
CTCTGAGAAATTATGTTGGAAGCAGCATACTTTCAAATTATTACCATGAGTATAATTTTA
AGAATGAAAATGTTTACAGTATTTTCAGTTTTATTATAAAAATGCACACACAA
caaagattgtcatttcttggctctacttgcattcagcacttgttcttgagcagctttctt
tgcttttaccatctcgacaagttcctaggaagggagaaaggtgtgatttaagaagttgcg
atttaaaaacagacattttaatctagtgtttggtgtaaagaattcaagcaactaagatag