Gene NPTX2 Variant 1
DNA : 12.57 KbNT_079595
mRNA : 2700 bp NM_002523
CDS : 1296 bp NP_002514
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  591 bp
ctcccgcccggccgccaggcgcgcaacggaaagcgcccccgccccgccccgctccgccca
ctgcgtgacgcgcacccggccgagccaatcagagctcgtggcgcgcgccccacacgccgg
ccccctccgcccctcagcttaagaaagggcgcgcggacccggcaggccagagtgccgagc
AGCGCGGTGGGTGCGGCTGTGAGACGGCAGGAGACTTCTGCCCCGCGGTGCACGCGACCC
TCGAGACGACAGCGCGGCTACTGCCAGCAGCGAAGGCGCCTCCCGCGGAGCGCCCCGACG
GCGCCCGCTCGCCCATGCCGAGCTGAGCGCGGCAGCGGCGGCGGGATGCTGGCGCTGCTG
GCCGCCAGCGTGGCGCTCGCCGTGGCCGCTGGGGCCCAGGACAGCCCGGCGCCCGGTAGC
CGCTTCGTGTGCACGGCACTGCCCCCAGAGGCGGTGCACGCCGGCTGCCCGCTGCCCGCG
ATGCCCATGCAGGGCGGCGCGCAGAGTCCCGAGGAGGAGCTGAGGGCCGCGGTGCTGCAG
CTGCGCGAGACCGTCGTGCAGCAGAAGGAGACGCTGGGCGCGCAGCGCGAGGCCATCCGC
GAGCTCACGGGCAAGCTAGCGCGCTGCGAGGGGCTGGCGGGCGGCAAGGCGCGCGGCGCG
GGGGCCACGGGCAAGGACACTATGGGCGACCTGCCGCGGGACCCCGGCCACGTCGTGGAG
CAGCTCAGCCGCTCGCTGCAGACCCTCAAGGACCGCCTGGAGAGCCTCGAG
gtagcggcccgcggggagcgcgggggacctggaatggggacgctcccgagtcgggggcgg
aagactcgggaggatggggaaagggggcctggccctggggagggtgtgatcgtccgtggg
ggtgagctggacttgagggtgaaaggcggggatctagatcctgctcgggaactcccctgc
EXON 2  217 bp
actttgaaatcttttccataccaaaaaagcatcagtgagatgctcccctgcctgccagtg
gcaagattcagggcttgcgttttggaagcttctccctgtgtggtcgggccatcacagcca
catttcacaatttctttttaactctttctgtgcccctccctcctccccggtggctgaaag
CACCAGCTCAGAGCAAACGTGTCCAATGCTGGGCTGCCCGGCGACTTCCGCGAGGTGCTC
CAGCAGCGGCTGGGGGAGCTGGAGAGGCAGCTTCTGCGCAAGGTGGCAGAGCTGGAGGAC
GAGAAGTCCCTGCTGCACAATGAGACCTCGGCTCACCGGCAGAAGACCGAGAGCACCCTG
AACGCGCTGCTGCAGAGGGTCACCGAGCTGGAGCGAG
gtgtgtgcctggcctgtttctctgtctggcagtggcctgattttcaccacttgtggtcag
acatgcgattctggttgatggacagcagggattgtgacaccacatgggcctggttcccga
gtgtgtgagcaaataataaaggcgactgaacaaggtcatctcaggaatgagctgccagcc
EXON 3  245 bp
ccagacttcagccttttatcagtggctggtgtggagcggtctttggtcgcttgctggagg
gtccatcaaggctgtgtgagggaccttcttgtgggtctagcaagatgtggctctgggccg
tgctggtgggtggtggggtggcctaacgcactcctggcctctcttcctcccaacccccag
GCAATAGCGCCTTTAAGTCACCAGATGCGTTCAAGGTGTCCCTCCCACTCCGCACAAACT
ACCTATACGGCAAGATCAAGAAGACGCTGCCTGAGCTGTACGCCTTCACCATCTGCCTGT
GGCTGCGGTCCAGCGCCTCACCAGGCATTGGCACCCCCTTCTCCTATGCGGTGCCAGGGC
AGGCCAACGAGATCGTGCTGATCGAGTGGGGCAACAACCCCATCGAGCTGCTCATCAACG
ACAAG
gtgaggcccgcctgcaccgccaccctccccagaacccatcatgtggtggagggagccaca
gcccccaccccagccgtcctcgccctcctcgggccacacagcagtgtcccagacatggga
ctgcggggctgtcctcctcgaggtggggatagctttgcacacgccgggcggctcacaggg
EXON 4  180 bp
tgctctggggtcagggtttccaccaaggctgcccccttgcatgttctccacgcatgaccc
cggtgacaggaggagcagtgtggcccagggggactgtggggtgtccttcctgcttcctgc
cctgggggaccctgagggcgtgggcccagcaggtccttacctgcacattgctgctcacag
GTTGCGCAGCTGCCCCTGTTTGTCAGTGACGGCAAGTGGCACCACATCTGTGTCACCTGG
ACGACACGGGATGGCATGTGGGAGGCATTCCAGGACGGAGAGAAGCTGGGCACTGGGGAG
AACCTGGCCCCCTGGCACCCCATCAAGCCCGGGGGCGTGCTGATCCTTGGACAAGAGCAG

gtgggtgcagggcaggtgcaggtgggcacagggtgggtgcaggatgggcacagggtggcc
gtgcgccctttcagggatggtgcgaggaggggccaactgagcagcacgaggccaggcctg
cagctgttcctgctcccggccccagctgttggcccctcagacctggccacagtgtcctga
EXON 5  1467 bp
atttgagcgatgccacctcccagttctgacatgcctgggagcttcagaacctacagaaac
aggtagtgttggtcagagctggggggcatcagagaaatgcccaaatctcctgtctgcagc
ccgtgtgcagggggacttgtgaaccagccctgacgcagctctcttgttcccattccccag
GACACCGTGGGGGGTAGGTTTGATGCCACTCAGGCATTTGTCGGGGAGCTCAGCCAGTTC
AACATATGGGACCGCGTCCTTCGCGCACAAGAAATTGTCAACATCGCCAACTGCTCCACA
AACATGCCGGGCAACATCATCCCGTGGGTGGACAATAACGTCGATGTGTTCGGAGGGGCC
TCCAAGTGGCCCGTGGAGACGTGTGAGGAGCGTCTCCTTGACTTGTAGCCGCCTTCTCCT
CTGTCCAGGAGGCCGGGATCAGGCTGTTGCCATGGAAGTTCAGGGCCATAGACTGCCCCA
CTTAAACTCTTGTCAGTCTGGGCTCAGGGTTCCCAGAGCTCATTCCCCAGGAATCTCTAA
GACCAGGGCTGGGGCAGTGTCTGTCACTGGCTTGTTTGTTCCCTACCAATATTCTGTTGC
TGTTTGAAGTAGTGCCAGGGTCCCCTGGGAAGATGCCCCCAAGACACCTGCCCCAAGTGG
GTGGATATCTGCCTTCCTGCTGCAAGTGGAGGCAGGTCCAGCAGCCCCTCTTCAGAGCCC
CTGTAAATGCTATCGCAGCCTGAGTCCTGCCGCCTTCCAGTTCCTTGGTGTCCCGTGCAC
CCCTTCTGTCTGTCCCCTTTCATGGCTGTGCAGCCGTCCCGCTGGAGTGGCCATGTCCCT
TGTGCATTGAGTGCATCCCCGCTGGTGACTAAGCTCGCAGCAAGCGGCTACCCCCCGATC
TGCAAAAGGGCCTCTCCCTTTGTGTTCTATACATTGTGAATCTTCCCGTCTGAAGAACGC
CCAGCCTGCCCAGACAAAGCCCCGCCTTCCCCAAAGCAGAGGGGCTGTCTGTGTCTCCAG
AAAGGGGACATCGGGGGGGAGGGGGGCTCAGAAAGGAGAAGGGCTGTGATCTCCGGTCCC
TTCCCCCATCATCCTTCCTTAGACTGATGCTTTGACTGAATCATCACTAGCTATGGCATT
AAAAGGCCTCTCTTCTCATCTGGTGCCAAAGGTTCCGTTGCAGCTTTTTACAACCATCCG
GTGTGGTTTGGAGGATTTGTTTTTTTTTTTTCCCAACAGAAAAGAACAGCCATTAGAAGA
AGGCTCCCATTTTCTGATGTTCCGCCCCACTGTGAAGAGTGTGCTCGTTTTAAATTCATG
TTGATTCTTGTAAGCACTGGACTGTCTTCATCAAGTATTTCCCTACAGAACTCCTCAAGA
AAACAGAGATCATTTGGCTAGAGATTGTCTGAGTGACTCCAAGCTACTCACTGTATTGGA
CGGGAGTAGTAATTTATTTTAAAGATAAAGTGACTAAGTGGGGAAATTTATAAAGCTAAA
TATTATATATTTTATTTTTCATACATGTTTGAAGTGCAAATCTGTGGATATTCCATTTGT
AGGACCAAGTCGACATGCCCATCCTGACATTGTATGCTACGAGAACTCTTCTGATGATGG
AATTTCGATTAAAGTGCACTGAAAGAT
gcttctgtgtttgtcttcctcatgttctggggctgaaggtgggaaggggtagggctttgc
aacttctggcagaaggatgatgtctctggtttgccgcagcctgcttctggtgggtttggg
ggcgctgaggatggttagaggagggtgtggtccagctgtccatccttcctatttcaatgc