Gene NEUROD6 Variant 1
DNA : 3.46 KbNT_079592
mRNA : 2157 bp NM_022728
CDS : 1014 bp NP_073565
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  332 bp
atcatcaacaacaaaaaaaacctcttgctcacacaaaagcccaccttgtaaatgaatgga
atattaacgatcacctaatacttgcaccgttggcagggcgaaactgaacactaacacagc
tatttctacagattgccagtgaaaccgaagcagttcgaggagaaatgcacctactgtacg
TGAAATGCTGGTGCAGATTTTTTTCCTATCAGTCTAACCTTCTGTGTTGATGCATGAAGG
CTGGTACCCACTTACAGGGATGCCAGATGATCAGTGCAGAATGAAGGTCCCAAGAGAGAG
GATCACATGGCTCTCTCTGCCCTGTGACGTCACTAGCAGATGGCATGGGTACCAGCTCTG
GCAGTTGGCATCAATGTCACTTTTTAGAGATCAATGAGATAGTGCAGATATACACAGATC
TAGAGACTCCAGGAGACGATGCGACACTCAGCCTGAAAAGATTTGGAAGACCCAAAATGA
AAACTGATTATTGAATGAAATTAAAACCTAAG
gtaatataaataaagatatacttcaattgatgctggctttgcatgcaagtatttaaagat
acagtgtcactgtcttatagtatttatatgctctttgccatctataacttatcatatttc
attcttatgatgtaattatcacatactttcactgctattatgtaacactgcaagtatgtg
EXON 2  1825 bp
atgtcttcataattacttatcttcacaaactcaaaattatatttaatgttaaaaaatcag
gcccagaatcagtctttttcacgtgtttttgtaatcttatgattaaataattaaatatgt
tttaagtgtataaactttaaaaatgaaaaccctttaaatattgtgctggcattttttcag
GTAATTTAAGATTAGAGAACCATGTTAACACTACCGTTTGATGAGTCTGTTGTAATGCCA
GAATCCCAGATGTGCAGAAAGTTTTCTAGAGAATGCGAGGACCAGAAGCAAATTAAGAAG
CCAGAAAGCTTTTCCAAACAGATTGTCCTTCGAGGAAAGAGCATCAAAAGGGCCCCTGGA
GAAGAAACCGAGAAAGAAGAAGAGGAGGAAGACAGGGAAGAGGAAGATGAAAATGGGTTG
CCTAGAAGGAGGGGTCTTAGGAAAAAAAAGACAACAAAGCTGCGATTGGAAAGGGTCAAG
TTCAGGAGACAGGAAGCGAACGCGCGCGAGAGGAACAGGATGCACGGCCTCAACGACGCT
CTGGACAACTTAAGAAAAGTGGTCCCCTGTTATTCTAAAACCCAGAAACTGTCCAAAATA
GAGACTTTACGACTGGCCAAAAACTACATCTGGGCACTTTCTGAAATTCTGAGAATCGGC
AAGAGACCAGATCTGCTCACATTCGTCCAAAACTTATGCAAAGGTCTTTCCCAGCCAACT
ACAAACTTGGTGGCAGGCTGCTTGCAGCTCAACGCCAGGAGTTTCCTGATGGGTCAGGGT
GGGGAGGCTGCACACCACACAAGGTCACCCTACTCTACCTTCTACCCACCCTACCACAGC
CCTGAGCTCACCACTCCCCCAGGGCATGGGACTCTTGATAATTCCAAGTCCATGAAACCC
TACAATTATTGCAGTGCGTATGAATCCTTCTATGAAAGTACTTCCCCTGAGTGTGCCAGC
CCTCAGTTTGAAGGTCCCTTAAGTCCTCCCCCAATTAACTATAATGGGATATTTTCCCTG
AAGCAAGAAGAAACCTTGGACTATGGTAAAAATTACAATTACGGCATGCATTACTGTGCA
GTGCCACCCAGGGGTCCCCTTGGGCAGGGTGCCATGTTCAGGTTGCCCACCGACAGCCAC
TTCCCTTACGACTTACATCTGCGCAGCCAATCTCTCACAATGCAAGATGAATTAAATGCA
GTTTTTCATAATTAATGAGGAAAATGAAAATAAACAGTGGTCATTCACCTCCCCTGTCTA
ATTAAGACAAAGCAGATGCTTGTGGGCTGAGTAATTGGCACAACTCTATCTAAGGTGTTT
ACTAGTTTCTGAAGTGTGTTTCAACTATTGTGAGAATTTTCTATGTAATAATAAATCTCT
TTTCGTATGAGAACTTCTTTTCCTTTCCTTTTGTCTGTGAAGCACTGTGATTCTGTTTCT
ACTGGAAAGATTTTTTTCTTTTTAATTTTCTTTTAAACTTATTTAATTTGTTTGAACAAG
GTGTCTAAGAATATACTGTTGAATAAAGACATGCACACAGCATAATTCAATGTCTATTTT
GGTTGTACAGTAATTATAAAATGCATGTTATTAAAACCAGATGAGTAAAATGATGTGTTT
ATAATTATTAGGAATTATATATTATGTATCTTTTAAAAATTGAAATTTTAAAATATGGAG
AATATCACTAAGCTGACAATGATATTGGGAGATGAATTTGCAACAATATAAAAAGCTATG
CAATTTTCTTTTTATTAAGGATGAATCTAAATGCATTCAATTGGTAACTATTCCTCTTCA
AGTATTTGCAGATGGGGCAACATGATATTTGGGTAGCTGATGTCATAATTCGGGGACAAT
TATCTCAATCATCAAGAAAAAAATTTCAGCACTTGTTTTGTATTATTCAGAAATTAACTG
TACAGGTTTGTTATCACAATGTATAATTGTGTTTTTCCACCCCACATTTTTAAGGCAATT
AAATATAGATATTTCCACTCGTAAA
ggacatctactagctgtgatatttttgcatgctacttattatttcctggcacacagctgc
tttctgtctccaatactccccactcctcatttcagaaatatttctggattacaaaaccgt
aggagctaaaacaaatttcttaaacagaatggccaaagcgcttacaagaatttttttttc