Gene MEOX2 Variant 1
DNA : 75.40 KbNT_079592
mRNA : 2270 bp NM_005924
CDS : 912 bp NP_005915
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  697 bp
tggtcaactctgggctcctaagccagcccccagctcacgttacactctatttataacttc
tcagagccatttccccctgaaagcagttctctgggaccaccttcttttggcttcaacctc
tcccactcttgacatctgagtagctcagggaagctcttccaggtccgactgttcatatgt
AAAGGAGACTGGCCGCTGGGGCTCAGGACCGGGATTATCCGAGCTCTGCAGAAGTGCACC
GCTATTGCTTTGGGAGGTTAAAAAAAAAAATCACACGGTTTCCAGTGAAAAAGTGACAGA
GGGTGGTGGCCTTTGGAACCGCCGTGAAGTCTTCTGCCTGGAACCCGAAACTTGCATGCT
ATGGAACACCCGCTCTTTGGCTGCCTGCGCAGCCCTCACGCCACGGCGCAAGGCTTGCAC
CCGTTCTCCCAATCCTCTCTCGCCCTCCATGGAAGATCTGACCATATGTCTTACCCCGAG
CTCTCTACTTCTTCCTCATCTTGCATAATCGCGGGATACCCCAACGAAGAGGGCATGTTT
GCCAGCCAGCATCACAGGGGGCACCACCACCACCACCACCACCACCACCATCACCACCAT
CAGCAGCAGCAGCACCAGGCTCTGCAAACCAACTGGCACCTCCCGCAGATGTCTTCCCCA
CCGAGTGCGGCTCGGCACAGCCTCTGCCTCCAGCCCGACTCTGGAGGGCCCCCAGAGTTG
GGGAGCAGCCCGCCCGTCCTGTGCTCCAACTCTTCCAGCTTGGGCTCCAGCACCCCGACT
GGGGCCGCGTGCGCGCCGGGGGACTACGGCCGCCAGGCACTGTCACCTGCGGAGGCGGAG
AAGCGAAGCGGCGGCAAGAGGAAAAGCGACAGCTCAG
gtaagggcgcgccaggcaccctcgagagtgcgcgccgggctggaaaaggggcggagagat
actaggggagattctcgcactggagggtggcagcagggaagatgggaatgtgttgccctc
tgtggcttcctgcggccaaattcggcggtgaagctttggtcctgatatttggggacacgt
EXON 2  173 bp
aaaaaataagaattatatctccccccgttgagctgccgtcagtcttgctgtctttggtct
ctatttgttccatgtctagcgcagtacctggaaaagtagtaattcaataactgtgaataa
tatgattgcatgtgtttgaataaatgagttattaccaattctgtctcccttttttttcag
ACTCCCAGGAAGGAAATTACAAGTCAGAAGTCAACAGCAAACCCAGGAAAGAAAGGACAG
CATTTACCAAAGAGCAAATCAGAGAACTTGAAGCAGAATTTGCCCATCATAATTATCTCA
CCAGACTGAGGCGATACGAGATAGCAGTGAATCTGGATCTCACTGAAAGACAG
gtaaagctgggcattatcattatatgatcttttttaattgccctgggtccacagtcttct
ttgccatatttgaaatacctagatccagaattcttgaataccatttggaagacagttata
ctattccatgataaaattttgccagcaaaataacaaaattaaaaataatatagtgatatt
EXON 3  1400 bp
attatcatgaacatgtaacctgattaaattcaacgtggatttatttttctattcactcct
tcatggtgtctttgtataagcctttgaggaacttcttttcattgatgacactaaggagaa
aaaaatgtcactttaattatctctttttttctgtttgtttgttccctttcttggttgaag
GTGAAAGTCTGGTTCCAAAACAGGCGGATGAAGTGGAAGAGGGTAAAGGGTGGACAGCAA
GGAGCTGCGGCTCGGGAAAAGGAACTGGTGAATGTGAAAAAGGGAACACTTCTCCCATCA
GAGCTGTCGGGAATTGGTGCAGCCACCCTCCAGCAAACAGGGGACTCTATAGCAAATGAA
GACAGTCACGACAGTGACCACAGCTCAGAGCATGCGCACTTATGATATAAACAGAGGACC
AGCTCCATTCTCAGGAAAGAAATGTTGTGATGGCAAGCCTTACCCAAATATCGTTTACAC
AGAGAGATGACTATGGCAGTGATGTTTAATATTATAAAATCCAGGCATTTCGAATCTGTT
TTTCATGATTTATAGAGGGTTTACACAAAGTGCCACTTATTAAAGAGCTTCCACAGTGAA
GATGGAGAAGGTGAACTTGCTTTGAATATTCCAGATGTGTTTGGTCATGCGTATGGCAGT
GAGCAGGTATGTGTTTGCTTTTGCTTGCACTGAAAATTAAATTGCTATCAAGAGCAAACT
ATGAACGGTTTTTTATTCAAGATGTCTCCAGAGTGAAGATGCCGAGGATGAACTTGCATT
GAACATTCCAGATGTGTGAGATCATGTGTATTACAGTGGGCAGGTATTTGCTTTTGCTTG
CACTGAAAATTAAATTGCTATCAAGAATAAACCATGAAACATTTTATCCTGAACAGCCAC
AGTGCCTGAATTCACTCAAGTGGATAAAAAGTGTATTTTAACTCTGTATATATTACCCTT
AAGTCATTTTCCTGTCTTCACTAATTTAGCAATGCATTCATATTAGCTGATGAAAATAGG
CACTCACAATGACAACCAGAGCCAGTTTCTTGTCTTTTTTATACATTTTGTCATCCCAGA
GACAATCAGTATGTGCTTACCTGTGTTCAAGTAGAGAAAAATACAGTAGAGTCTGATAGG
ACATATTCTTGTACCACAGACAAAACAAATCTTATGTTGCATTTACTATCAACTGCTGCT
AATACGTTATTATAAAACTTACCTAGCTCCTGAATTCTTCCTATCTTATAGCTTAAAACA
ATTAGGATCATAGGCAAATCAGTTACCTTGCAGAAAGAGCTTTGTATGACAGACATTGTC
TTATTTTATTTCTGTAAAATATTAGCTGTATGAATATGATTTAATTAACAAGAAAACATT
TCTTCCTGATTGACAACAGTGTTAGACAAGGTGCAAAGCGAAACTGGTTGCTCAAGTTGA
TAGAAAACAAAATTCTGAATATCTTCAAATTAAATTCGGTAAAAACACATTATTTTTTCA
TATGTGATGTATTCATGCAGAACAACTATCTTTGTATTTTGTTTTTAAAATGTGTTTAAT
AAATGATCCTTTGTAAATAA
ctttggtctccctacattaattttcttaatttttatagatttcaatatcaatgattaaca
aagtctcaaatctatctgcacttgtgcaaatccagatgattataattagtggattattta
cattttttcatttctgaatttttttattatggcaggaaaaaaataaatccttgtgtaatc