Gene HTR5A Variant 1
DNA : 13.60 KbNT_079596
mRNA : 1074 bp NM_024012
CDS : 1074 bp NP_076917
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  741 bp
accatctccaacggatgctcactagcaggaaattggggccaaattcacaggcactttcca
gaaactcccccactggccagaggttgcaaacatccggattggctctgggcacagtggccg
ccttaagtcctcctgaacaccccttctgcaagtaccccagggcggtctcctgacccagag
ATGGATTTACCTGTGAACCTAACCTCCTTTTCCCTCTCCACCCCCTCCCCTTTGGAGACC
AACCACAGCCTCGGCAAAGACGACCTGCGCCCCAGCTCGCCCCTGCTCTCGGTCTTCGGA
GTGCTTATTCTCACCTTGCTGGGCTTTCTGGTGGCGGCGACGTTCGCCTGGAACCTGCTG
GTGCTGGCGACCATCCTCCGTGTACGCACCTTCCACCGCGTGCCCCACAACCTGGTGGCA
TCCATGGCCGTCTCGGATGTCCTGGTGGCCGCGCTGGTCATGCCGCTGAGCCTGGTGCAC
GAGCTGTCCGGGCGCCGCTGGCAGCTAGGTCGGAGGCTGTGCCAGCTTTGGATCGCGTGC
GACGTGCTTTGCTGCACGGCCAGCATCTGGAACGTGACGGCCATAGCCCTGGACCGCTAC
TGGTCCATCACGCGCCACATGGAATACACGCTCCGCACCCGCAAGTGCGTCTCCAACGTC
ATGATCGCGCTCACCTGGGCACTCTCCGCTGTCATCTCTCTGGCCCCGCTGCTTTTTGGC
TGGGGAGAGACGTACTCTGAGGGCAGCGAGGAGTGCCAGGTAAGCCGCGAGCCTTCCTAC
GCCGTGTTCTCCACCGTAGGCGCCTTCTACCTGCCGCTCTGTGTGGTGCTCTTCGTGTAC
TGGAAGATCTACAAGGCTGCCAAGTTCCGCGTGGGCTCCAGGAAGACCAATAGCGTCTCA
CCCATATCCGAAGCTGTGGAG
gtgggtatctcagcaatccttaaaaatactcgacttgcatctgtacaggctatatcccca
ggccacctgccccacccccacacttgtagaaaatggaactttttgtgtttgggagtgggg
ggagtaaactgggagagtggaagaaagcatcagagatgtactttgctctgacatgttccc
EXON 2  333 bp
gctctgttgcctggtttccatatctgagagcgagtgccacaggccttcaggttcccacac
ctatccatcgaagactttcccttgagtggatgtgcggaatccaggcctgtcagtgtccag
gctcagcctagcaggtagactgaggtggctcctcataaagctcctgcttgtcttttacag
GTGAAGGACTCTGCCAAACAGCCCCAGATGGTGTTCACGGTCCGCCACGCCACCGTCACC
TTCCAGCCAGAAGGGGACACGTGGCGGGAGCAGAAGGAGCAGCGGGCCGCCCTCATGGTG
GGCATCCTCATTGGCGTGTTCGTGCTCTGCTGGATCCCCTTCTTTCTCACCGAGCTCATC
AGTCCCCTCTGCTCCTGTGACATCCCCGCCATCTGGAAAAGCATCTTCCTGTGGCTTGGC
TACTCCAACTCCTTCTTTAACCCCCTGATCTATACGGCTTTCAACAAGAACTACAACAGC
GCCTTCAAGAACTTCTTTTCTAGGCAACACTGA
gggagaggaccaggattgaaaaaagtttcttcccataattcagtggaattcccagttcat
ccatttcccatccccacccaacagccatgtggacgggatgaatcctcaccattctccagg
gtcatcttcagaactgcactggccgcttttccacctcctcagtaggaatatgactcctca