Gene HOXA3 Variant 3
DNA : 7.81 KbNT_079592
mRNA : 2773 bp NM_153632
CDS : 858 bp NP_705896
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  76 bp
ccctcctcccgccaccgccgagctccccttctccctccggtccctcccctcgcctcagcc
ccatcccccacaccagcccgcgcttccccagccgccttggtctcccctcccgcccgcccc
aacaccccccaccgcacccccggaccagacgctgctccgcgtgtaatattcataagaaac
ATACCCAAGTCGGTGCCACTAGCCCAGGCAGAGCCCGGCGCCGCACTAGCGCTTATCTCC
GGGCCGCGGCTGCTGC
cctcgggaagggcagggggcgggggtgtgggggaggggtgggtgggtggggtgggtggga
ggggggtccaagccgccccagtcggccctgggcgagccgtgctggagcagcgaggcggcc
acgctctgcgcggcggtgaccgggcctcggggtctccagcccgcctgccatctcggctga
EXON 2  166 bp
caccccaaggcacacgaactgagtgaggcgtgcctgcgcaccctgagcgccccacctagc
cagcctccaagcctgggagagccgcccctgcacccgccgccgccccaggccgcgccccct
gccccacagccgcctcagcccgcacctcagccccctgcacctacccctgccgcgcccccg
CCTCCCTCTTCTGCCTCCCCTCCTCAGAATGCCAGCAACAACCCTACCCCTGCCAACGCG
GCCAAGAGCCCCCTGCTCAACTCACCCACAGTGGCCAAACAAATCTTCCCCTGGATGAAA
GAGTCTCGACAAAACACAAAGCAGAAAACCAGCAGCTCCAGCTCAG
gtaaaggagtgccttctggaagagggtcctctggcctggctcctggtccccaagctactg
cccacgacatccagcacagcctaggagcgatggagcatgtctggaattcactgctcccac
accactgcccaccaaaaaggttttcatagtctttgcaacttagggaggtgataggcctct
EXON 3  2531 bp
agggagtatcactgttttacccaccaggagagaggatagcacctagttcctacttctctc
tgggacctgacggatgcaggaacctttggggcctggtggaaggaggggccgggctgggtc
aggggctgggcggggccgcggcagcccctgacgccgctcttcctctctctgtcctcgcag
GCGAAAGCTGCGCTGGCGACAAGAGCCCGCCGGGGCAGGCTTCGTCCAAGCGCGCGCGCA
CGGCCTACACGAGCGCGCAGCTGGTGGAGCTGGAGAAAGAGTTCCACTTCAACCGCTACC
TGTGCCGGCCGCGCCGGGTGGAGATGGCCAATCTGCTGAACCTCACTGAGCGCCAGATCA
AGATCTGGTTCCAGAATCGCCGCATGAAGTACAAAAAGGATCAGAAGGGCAAGGGCATGC
TAACGTCATCGGGGGGCCAGTCTCCAAGTCGCAGCCCCGTGCCCCCCGGAGCCGGTGGCT
ATCTGAACTCTATGCATTCGCTGGTCAACAGCGTCCCGTATGAGCCCCAGTCGCCCCCGC
CCTTCTCCAAGCCCCCCCAGGGTACCTACGGGCTGCCCCCCGCCTCCTACCCTGCGTCCC
TGCCCAGCTGCGCACCCCCGCCACCCCCACAGAAGCGCTACACGGCGGCAGGGGCGGGCG
CAGGGGGCACCCCCGACTATGACCCGCACGCTCATGGCCTGCAGGGCAACGGCAGCTATG
GGACCCCACACATACAGGGAAGCCCCGTCTTCGTGGGGGGCAGCTATGTGGAGCCCATGA
GCAACTCCGGGCCAGCCCTCTTTGGTCTAACTCACCTCCCCCACGCTGCCTCGGGCGCCA
TGGACTATGGGGGTGCCGGGCCGCTGGGCAGCGGCCACCACCACGGGCCGGGGCCTGGGG
AGCCGCACCCCACCTACACGGACCTTACCGGCCACCATCCTTCTCAGGGAAGAATTCAGG
AAGCACCCAAGCTCACCCACCTGTGATAGTGGGCTTGGGGCTACGCGCCAGGAGAGTCTC
CCCCCACCCACCTTTTTTCTTTGGTTGCTTTTTTTTTTTTTTTTTTTTAGGTTCTTCCTG
CCCTTTCCTTCCTTCCTTTTCTCTCTTCTCCGCCCCGCACTCCGTTTCCCGGTTTCCCCC
CTCGTTGGTAAGGCGTTTTTATAGTTTATGTGACGTAGCAATCTTGGTTGCTGGAATGGC
TGTATCATAGCGATATTTATCTCTTCCTGCTCCTCGATAGGCCACTGGCCCTGCACCCTT
TACCTTCTCCACTCTTTGATCAGAAACAGGGTATATGAACAAATTTTCTAGTCGAGTTTT
CAATGTGAATTTGTTCTTACATTATGGCTCCCGAGGGGAAGCGATTACTTTTTTTAATTT
TAAATTTTTTTTTTAATTGCACTTCTTGTAAAGAGTGAGAAAAAAAATCAAAGGCGCTTT
GAAACAGGGGCTCTCTGTGCAAGGATGACTAAGTGTACGTCTTTCCGTGTGTGTATGCTG
GTGAACAGTCAGATTTATTTATATTTTTTTGCAAGCATTGAATAATCTAAGTTTTAAATA
TTATTTATCCCCATCCGTTCGTATTTATATTAAAGAATTCTGTACCCTGATGGTTCAGAA
GGGTTCTTGGGCCTTTTGTTCAATTGTGTATTGGCGTACTTAGAATTTTTTTTATTTGAA
AGAGAAATATAATTCCTTTAAACGGTAACGATGCAATAAAACCAGAGAAGATCCAGCTTT
TGAAAACAGTGATTTAGGTTTGTAACATCCGGCAAAACTGAAAAAAAAAATCTGTAAACG
CGAAAAATACTAGATTTGTTTTGAGAGTTCTTCATTCCTTGCTGCTCACATTCTGAGAAA
CAAAAAGAAATAAAGTTTTTATTCTGAATAATATCCGTGTTAAGAAGGGGTTCTTTGGCC
GAAGACGTGGGTCTGCGTGGAATTCAGGCCGAGGCGAGCCGGCAGAGCAGGCCGGACGCA
GCAGCCCTCTGGCTCCAGCATGGGGCCTGGCCAGGCTATTCGCCTGGAAGCTCGGCGAAT
TCTCAGGATGGCGGCTGGGGCTCCAGGCGGCTGCGGCAGCTCTGGTAACGCCGTGCGGCG
GGCCAGCTGGGCTGCCCGGTTCCCAGCTGCTGCGGAGGCAGGCTGAGGGCGCAGGGGCTG
CCGAGTGCTGTGCACGGAAGAAACAAAGACATCCCGGCCCAAGGCGCAGCGGGAGCGCAC
AGGTGCCCCGCGGCCCAGCCGGGGGATAACGCAGGGCGGTCTTCTGCTCCATGCTCTTCC
TCGGGTCAAAGCGGACCAACTAACGCCTAAACCTCGGTATTAGCCAGCCGCGCAGAGGAT
GCCGAGCACTTTCCGGGAGCAATCGGACTCCTGGTCTCCTCTGGGGATGCTTCGCGGTCT
GTTATCGCGTCAGGAGGAAAGAATTGCTCCAAAAATCTGCACGCGGAGCGAAACAGTTTG
AAAGGGACTGAGGCTCACCCAGGTCTCCAGCAAACGGAGGACTGAACTGGGGAGAGTCAC
CCTGAGCCAGCCCTTCCCTGGACTGCCGGAATCCCAGCATTAGCTTCCTGCTGAATGTAG
TATTTGGCATTCTCTGAATTTATTTCCTCTCCTTCCCCCACCCAGCTTTCTTTTTATGGC
CCCAGGGGGAGGGGGAGAGAGCAAGGAGATCGGTATCTTTGTAATAAAACTGCAATTTTA
TAAATTTTTCA
tttgatgttgtaggagctaaatattacatttccactcctggatttaagatagggctgctt
actgactggctagaagaggcaaaagaaggcacagtaaagggaaatattttcatcttcaga
tttaaggattcctcgagaaaggaatcaaattcagaaaatgcagacctcagacctgcatcc