Gene HOXA3 Variant 2
DNA : 13.41 KbNT_079592
mRNA : 3257 bp NM_030661
CDS : 1332 bp NP_109377
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  80 bp
aacaagttctcttatgaaaggccttacattttcatcagaccccttctgttcctctgcagg
ggaggagtgaaggggaggaatcatgcacagcctcctgcagctgctataagtgagtcctca
cactcaggcatagccagctgaagacccattctccaggaaaaaaagaatatggcctgagga
TCTCACTAGCCTCAGAGCACTCTCAGAAGTTCAGAAACTAAGACCAGAAAAGAGAAGATT
TTTAGACAGCTCATGAAACG
gtacaatgttgaaattagtgggcaatgtcatcaggcagaaggcaggagtaggggtggaac
caagggtgggagcagcttatttgtttcagttaggttcttcctgagcacagttggttctct
actggttttctgctcaagattattttgagagttctgaagggggctctttctcatctttga
EXON 2  646 bp
ttgtagctgccagtaaattccagcggttttttatagcacggctccctgcgcccggggcca
agtcgtgctgctaaatattgctgaccactttttcttttatggctttcatgtcacttagct
attgagagtaagatggatttgcgcggagccctcaccgcgctgcgcttctcgccccaccag
GTCTGCGCGGGGCGGCCATTGGCGGCGGAGTGTCACGTGACCGCGGGGGCGTGCCAATGT
GCGCCCTCACGGGTGTCAAACCCCTGTCAGAGTGTGCGATCAAGATCGTGAAACAACGCG
ATGCAAAAAGCGACCTACTACGACAGCTCGGCGATCTACGGTGGCTACCCCTACCAGGCA
GCCAACGGGTTCGCTTATAATGCCAATCAGCAGCCGTACCCGGCGTCCGCCGCTTTGGGC
GCCGACGGCGAGTACCACCGACCCGCCTGCTCCCTCCAGTCTCCCTCCAGCGCCGGGGGC
CACCCCAAGGCACACGAACTGAGTGAGGCGTGCCTGCGCACCCTGAGCGCCCCACCTAGC
CAGCCTCCAAGCCTGGGAGAGCCGCCCCTGCACCCGCCGCCGCCCCAGGCCGCGCCCCCT
GCCCCACAGCCGCCTCAGCCCGCACCTCAGCCCCCTGCACCTACCCCTGCCGCGCCCCCG
CCTCCCTCTTCTGCCTCCCCTCCTCAGAATGCCAGCAACAACCCTACCCCTGCCAACGCG
GCCAAGAGCCCCCTGCTCAACTCACCCACAGTGGCCAAACAAATCTTCCCCTGGATGAAA
GAGTCTCGACAAAACACAAAGCAGAAAACCAGCAGCTCCAGCTCAG
gtaaaggagtgccttctggaagagggtcctctggcctggctcctggtccccaagctactg
cccacgacatccagcacagcctaggagcgatggagcatgtctggaattcactgctcccac
accactgcccaccaaaaaggttttcatagtctttgcaacttagggaggtgataggcctct
EXON 3  2531 bp
agggagtatcactgttttacccaccaggagagaggatagcacctagttcctacttctctc
tgggacctgacggatgcaggaacctttggggcctggtggaaggaggggccgggctgggtc
aggggctgggcggggccgcggcagcccctgacgccgctcttcctctctctgtcctcgcag
GCGAAAGCTGCGCTGGCGACAAGAGCCCGCCGGGGCAGGCTTCGTCCAAGCGCGCGCGCA
CGGCCTACACGAGCGCGCAGCTGGTGGAGCTGGAGAAAGAGTTCCACTTCAACCGCTACC
TGTGCCGGCCGCGCCGGGTGGAGATGGCCAATCTGCTGAACCTCACTGAGCGCCAGATCA
AGATCTGGTTCCAGAATCGCCGCATGAAGTACAAAAAGGATCAGAAGGGCAAGGGCATGC
TAACGTCATCGGGGGGCCAGTCTCCAAGTCGCAGCCCCGTGCCCCCCGGAGCCGGTGGCT
ATCTGAACTCTATGCATTCGCTGGTCAACAGCGTCCCGTATGAGCCCCAGTCGCCCCCGC
CCTTCTCCAAGCCCCCCCAGGGTACCTACGGGCTGCCCCCCGCCTCCTACCCTGCGTCCC
TGCCCAGCTGCGCACCCCCGCCACCCCCACAGAAGCGCTACACGGCGGCAGGGGCGGGCG
CAGGGGGCACCCCCGACTATGACCCGCACGCTCATGGCCTGCAGGGCAACGGCAGCTATG
GGACCCCACACATACAGGGAAGCCCCGTCTTCGTGGGGGGCAGCTATGTGGAGCCCATGA
GCAACTCCGGGCCAGCCCTCTTTGGTCTAACTCACCTCCCCCACGCTGCCTCGGGCGCCA
TGGACTATGGGGGTGCCGGGCCGCTGGGCAGCGGCCACCACCACGGGCCGGGGCCTGGGG
AGCCGCACCCCACCTACACGGACCTTACCGGCCACCATCCTTCTCAGGGAAGAATTCAGG
AAGCACCCAAGCTCACCCACCTGTGATAGTGGGCTTGGGGCTACGCGCCAGGAGAGTCTC
CCCCCACCCACCTTTTTTCTTTGGTTGCTTTTTTTTTTTTTTTTTTTTAGGTTCTTCCTG
CCCTTTCCTTCCTTCCTTTTCTCTCTTCTCCGCCCCGCACTCCGTTTCCCGGTTTCCCCC
CTCGTTGGTAAGGCGTTTTTATAGTTTATGTGACGTAGCAATCTTGGTTGCTGGAATGGC
TGTATCATAGCGATATTTATCTCTTCCTGCTCCTCGATAGGCCACTGGCCCTGCACCCTT
TACCTTCTCCACTCTTTGATCAGAAACAGGGTATATGAACAAATTTTCTAGTCGAGTTTT
CAATGTGAATTTGTTCTTACATTATGGCTCCCGAGGGGAAGCGATTACTTTTTTTAATTT
TAAATTTTTTTTTTAATTGCACTTCTTGTAAAGAGTGAGAAAAAAAATCAAAGGCGCTTT
GAAACAGGGGCTCTCTGTGCAAGGATGACTAAGTGTACGTCTTTCCGTGTGTGTATGCTG
GTGAACAGTCAGATTTATTTATATTTTTTTGCAAGCATTGAATAATCTAAGTTTTAAATA
TTATTTATCCCCATCCGTTCGTATTTATATTAAAGAATTCTGTACCCTGATGGTTCAGAA
GGGTTCTTGGGCCTTTTGTTCAATTGTGTATTGGCGTACTTAGAATTTTTTTTATTTGAA
AGAGAAATATAATTCCTTTAAACGGTAACGATGCAATAAAACCAGAGAAGATCCAGCTTT
TGAAAACAGTGATTTAGGTTTGTAACATCCGGCAAAACTGAAAAAAAAAATCTGTAAACG
CGAAAAATACTAGATTTGTTTTGAGAGTTCTTCATTCCTTGCTGCTCACATTCTGAGAAA
CAAAAAGAAATAAAGTTTTTATTCTGAATAATATCCGTGTTAAGAAGGGGTTCTTTGGCC
GAAGACGTGGGTCTGCGTGGAATTCAGGCCGAGGCGAGCCGGCAGAGCAGGCCGGACGCA
GCAGCCCTCTGGCTCCAGCATGGGGCCTGGCCAGGCTATTCGCCTGGAAGCTCGGCGAAT
TCTCAGGATGGCGGCTGGGGCTCCAGGCGGCTGCGGCAGCTCTGGTAACGCCGTGCGGCG
GGCCAGCTGGGCTGCCCGGTTCCCAGCTGCTGCGGAGGCAGGCTGAGGGCGCAGGGGCTG
CCGAGTGCTGTGCACGGAAGAAACAAAGACATCCCGGCCCAAGGCGCAGCGGGAGCGCAC
AGGTGCCCCGCGGCCCAGCCGGGGGATAACGCAGGGCGGTCTTCTGCTCCATGCTCTTCC
TCGGGTCAAAGCGGACCAACTAACGCCTAAACCTCGGTATTAGCCAGCCGCGCAGAGGAT
GCCGAGCACTTTCCGGGAGCAATCGGACTCCTGGTCTCCTCTGGGGATGCTTCGCGGTCT
GTTATCGCGTCAGGAGGAAAGAATTGCTCCAAAAATCTGCACGCGGAGCGAAACAGTTTG
AAAGGGACTGAGGCTCACCCAGGTCTCCAGCAAACGGAGGACTGAACTGGGGAGAGTCAC
CCTGAGCCAGCCCTTCCCTGGACTGCCGGAATCCCAGCATTAGCTTCCTGCTGAATGTAG
TATTTGGCATTCTCTGAATTTATTTCCTCTCCTTCCCCCACCCAGCTTTCTTTTTATGGC
CCCAGGGGGAGGGGGAGAGAGCAAGGAGATCGGTATCTTTGTAATAAAACTGCAATTTTA
TAAATTTTTCA
tttgatgttgtaggagctaaatattacatttccactcctggatttaagatagggctgctt
actgactggctagaagaggcaaaagaaggcacagtaaagggaaatattttcatcttcaga
tttaaggattcctcgagaaaggaatcaaattcagaaaatgcagacctcagacctgcatcc