Gene HOXA13 Variant 1
DNA : 3.20 KbNT_079592
mRNA : 2484 bp NM_000522
CDS : 1167 bp NP_000513
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  922 bp
cgctttgcatacgccgtgggcggagcgggggggccgggccaatgggcggccgcctggcgc
gaccccgcggggcgcgatccgcccccctcgctcgggccccggccccgcgccgcgcgctct
tcacttcttgggggctttttaaaacagcgccactggggtcttctccatgcggctcgggct
ATGACAGCCTCCGTGCTCCTCCACCCCCGCTGGATCGAGCCCACCGTCATGTTTCTCTAC
GACAACGGCGGCGGCCTGGTGGCCGACGAGCTCAACAAGAACATGGAAGGGGCGGCGGCG
GCTGCAGCAGCGGCTGCAGCGGCGGCGGCTGCCGGGGCCGGGGGCGGGGGCTTCCCCCAC
CCGGCGGCTGCGGCGGCAGGGGGCAACTTCTCGGTGGCGGCGGCGGCCGCGGCTGCGGCG
GCGGCCGCGGCCAACCAGTGCCGCAACCTGATGGCGCACCCGGCGCCCTTGGCGCCAGGA
GCCGCGTCCGCCTACAGCAGCGCCCCCGGGGAGGCGCCCCCGTCGGCTGCCGCCGCTGCT
GCCGCGGCTGCCGCTGCAGCCGCCGCCGCCGCCGCCGCGTCGTCCTCGGGAGGTCCCGGC
CCGGCGGGCCCGGCGGGCGCAGAGGCCGCCAAGCAATGCAGCCCCTGCTCGGCAGCGGCG
CAGAGCTCGTCGGGGCCCGCGGCGCTGCCCTATGGCTACTTCGGCAGCGGCTACTACCCG
TGCGCCCGCATGGGCCCGCACCCCAACGCCATCAAGTCGTGCGCGCAGCCCGCCTCGGCC
GCCGCCGCCGCCGCCTTCGCGGACAAGTACATGGATACCGCCGGCCCAGCTGCCGAGGAG
TTCAGCTCCCGCGCTAAGGAGTTCGCCTTCTACCACCAGGGCTACGCAGCCGGGCCTTAC
CACCACCATCAGCCCATGCCTGGCTACCTGGATATGCCAGTGGTGCCGGGCCTCGGGGGC
CCCGGCGAGTCGCGCCACGAACCCTTGGGTCTTCCCATGGAAAGCTACCAGCCCTGGGCG
CTGCCCAACGGCTGGAACGGCCAAATGTACTGCCCCAAAGAGCAGGCGCAGCCTCCCCAC
CTCTGGAAGTCCACTCTGCCCG
gtaaatgacgacctattcccagccctggtcttccggctctgctccagcttcttctccgct
cgcacccgggcgatcccgggtgcctttctgttctcttcctggtctgccctagcggctctg
cacccctgggagcccgagcatggctggctgggtctgcctgcactgcctcgagttgagctg
EXON 2  1562 bp
tcagttcagaactaactaccttccccactgaccctctaggctttagcagaagacaggatt
gtacagcgggtggcaaagagcagccgggcgctgcaaggcgggtggctcagatcgagctgt
cgcctatgccctggctggggtccgatccctgtgtaacttgccttctcccttgtcttctag
ACGTGGTCTCCCATCCCTCGGATGCCAGCTCCTATAGGAGGGGGAGAAAGAAGCGCGTGC
CTTATACCAAGGTGCAATTAAAAGAACTTGAACGGGAATACGCCACGAATAAATTCATTA
CTAAGGACAAACGGAGGCGGATATCAGCCACGACGAATCTCTCTGAGCGGCAGGTCACAA
TCTGGTTCCAGAACAGGAGGGTTAAAGAGAAAAAAGTCATCAACAAACTGAAAACCACTA
GTTAATGGATTAAAAATAGAGCAAGAAGGCAACTTGAAGAAACGCTTCAGAACTCGTTGC
TTTGCCCAGATAATGATAATAATGCTTAATAATAATTGAAGAATGGGAAAGAGAAAGAGA
CAGAGACTGGCATTTTCCTCTCCCGAAGGAGATCTCTTTCTCTTTAATGGAATCTACAAC
TGTTTTAAAACTTTAAGAAAGGTAAAGACTGCCAGTTCTTCCGCCAACCCCATCAGCCCA
GCCCGTTAAATGTCAAACGTCAACCCCCAAAATACGCAATTTCAGATAAGTTACGCAGTT
ACTGAAATCTTGTAAGTATTTAAGTGATCGTTACATTTTAGGACACTGCGTTAGATGGTA
ATAATCTGGAAGTTGGTTACAAACGCAAGAGGCCATTGTAAACATCTGCTTGTCCTTCTT
AGGTCGCCATTCCCTTTGCATGTTAAGCGTCTGCTCAGGTAAATCTTAGTGAAATTCCTA
CCGTTGTTGTACGTTCTGCAAAACATTTTATGTATAGATTTAGAGGGGAAACGAGAAGGT
ACTGAAATAATGATCTTGGAATATTTGCTGTGAAGGGAGAAAGGGAGAGAAAACTCTTCT
GAGGATCATTTGTCTTGGTAGTATAGTAAAACCAACCAGCTGAACCTTTCAGGCTACAAG
AGAACCCGGGTCGGTAATGTCTTTTTAAGAATAATTTTTAATTGCTTATAACAAGCATAT
TTTGTGGCATTTGAACTATATTTACTGCTCCAATATCCGTTATTTTCCAAAGGATTTTGT
ATCTTTTTGAAAATGTTTACATCATCAGATGATCCACAGAATTCACTTTATGTGAGATCT
CCCGAGAGTTTCCATCCCAACATAATGGACTTTGGTTTGAACACAATTCGTTTTTTCATT
TGAATTGGCATTTCCCAATATTTGCTAAACATTTGCTGGAGAAATCATTTTTCTTTTTTC
TTTTTTAGAAAACTCAGAATGAAAATTCATTCCCCTGAAATATTTAGGTGTCTATATTCT
ATATTTTGATCTATTAAGGGATTAGTATTTTTCCATGTTTATTGTGTTATCAGAGTGCAT
TAGAAAGATTAGTGATTCATCTTCACAGCACATTTTTAATCAAGCAGTTATTTCAACCAG
CACATTCGTTTTGTTCATATTCACTATAGAATGATATCTTGTAAATAAAGACATTCAGCA
CACTGTGAAAATGTATTTGTGCACCTGCTTTTTAAATATTTCTACTAAAAATGAAAAAAA
AACCCCTTAGACCTGTAGATAGTGATATCGTAATATTAATTGTTAATAAAATAGTCACTG
CC
attaaaatctgcagaaaatactctttactttcctatgctaaatgtgcactgcacagaaag
aaaaggagcaggtttatcttatataaaccaaggaccattctttattattattcagtactt
cttttgctaccaaatttttaagaaaagggagaaatccctcataactaaaatcctaaaaaa