Gene GUSB Variant 1
DNA : 21.52 KbNT_079593
mRNA : 2191 bp NM_000181
CDS : 1956 bp NP_000172
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  236 bp
aaaggcctagcctggggttccagccacaagccctaccgggcagcgcccggccccgcccct
ccaggcctggcactcgtcctcaaccaagatggcgcggatggcttcaggcgcatcacgaca
ccggcgcgtcacgcgacccgccctacgggcacctcccgcgcttttcttagcgccgcagac
GGTGGCCGAGCGGGGGACCGGGAAGCATGGCCCGGGGGTCGGCGGTTGCCTGGGCGGCGC
TCGGGCCGTTGTTGTGGGGCTGCGCGCTGGGGCTGCAGGGCGGGATGCTGTACCCCCAGG
AGAGCCCGTCGCGGGAGTGCAAGGAGCTGGACGGCCTCTGGAGCTTCCGCGCCGACTTCT
CTGACAACCGACGCCGGGGCTTCGAGGAGCAGTGGTACCGGCGGCCGCTGTGGGAG
gtgcgatctcggggcagggccgggaggcgcccgaaagcccggcggtgggagtaggggagc
ccgggccccccgcagacttcttcccctgggcgtctccgagctggggcccgcaggaggtta
aaggtcaacgggcttgggggcgccggcttgggggacgggggaacaggagcaccctggagg
EXON 2  186 bp
gcccaggtgcacagatcgccctggcagttgacctgtcatcagcaagttatctgtcctttc
tgccaagaatccccgctatgtgtcagggcttgtgctaggcctgggggcacagccgtgcag
cacactggtcctggacccttttgggggcctaggagctgagcccggctcttctctccacag
TCAGGCCCCACCGTGGACATGCCAGTTCCCTCCAGCTTCAATGACATCAGCCAGGACTGG
CGTCTGCGGCATTTTGTCGGCTGGGTGTGGTACGAACGGGAGGTGATCCTGCCGGAGCGA
TGGACCCAGGACCTGCGCACAAGAGTGGTGCTGAGGATTGGCAGTGCCCATTCCTATGCC
ATCGTG
gtcagtgcggccaggagcaggcagggcgggtgggggggcacggctgctgaacagcatggg
acctccagctgccacccacggcatgtatgctggggtgggatggtggggggtcctgccctg
ccctgccctgggggctgtgccctgtatagggggataggtagcctgatctaccccattggg
EXON 3  185 bp
ggctgtgccctgtatagggggataggtagcctgatctaccccattgggatgtcattcttc
ccgtctggctggaaggccccggagccccatgctgcaggttatgtgagggagtgcccgata
gtagggcgcctcctcatgccctgacctgcagccccctccccgtatctcctgtgtctgcag
TGGGTGAATGGGGTCGACACGCTAGAGCATGAGGGGGGCTACCTCCCCTTCGAGGCCGAC
ATCAGCAACCTGGTCCAGGTGGGGCCCCTGCCCTCCCGGCTCCGAATCACTATCGCCATC
AACAACACACTCACCCCCACCACCCTGCCACCAGGGACCATCCAATACCTGACTGACACC
TCCAA
gtgggtaccatcctgcctccattgcacacacccaccttcccgccccaccctgtggtcttc
ctggtagggactgggtggccttcacagagtggaggccttggatctggggaggccagggag
gcctgtgagctgaggtcaggggacccagagcaagggcccagcaaaccacagtcctcccat
EXON 4  143 bp
taccatcctgcctccattgcacacacccaccttcccgccccaccctgtggtcttcctggt
agggactgggtggccttcacagagtggaggccttggatctggggaggccagggaggcctg
tgagctgaggtcaggggacccagagcaagggcccagcaaaccacagtcctcccatcctag
GTATCCCAAGGGTTACTTTGTCCAGAACACATATTTTGACTTTTTCAACTACGCTGGACT
GCAGCGGTCTGTACTTCTGTACACGACACCCACCACCTACATCGATGACATCACCGTCAC
CACCAGCGTGGAGCAAGACAGTG
gtgagggcttctggtaggatcctctcagcggggcccagggtggctctgtttgttccctgt
ttggaaagctctcccaggaaaaaggtgctcccagcatctctacaccctcacagattccct
tccacctatgaagctaaaattcagcctgtgtgagcggatacgggctcccaaaatcacccg
EXON 5  188 bp
ctgcactccagcctgggggacagagtgagactccgtctcaaaaaaaaaaaataagaaatt
aaatttaaaaaaagcaacagaaacaaatggctgcctggcagcggtggctgcagggcgctc
ctgtttgtgtgactcaggtcgtgtccctccctcagccctggtctctcttgtttcttgcag
GGCTGGTGAATTACCAGATCTCTGTCAAGGGCAGTAACCTGTTCAAGTTGGAAGTGCGTC
TTTTGGATGCAGAAAACAAAGTCGTGGCGAATGGGACTGGGACCCAGGGCCAACTTAAGG
TGCCAGGTGTCAGCCTCTGGTGGCCGTACCTGATGCACGAACGCCCTGCCTATCTGTATT
CATTGGAG
gtaatggtggtttgggacatgcctaagggaggtcttttgcccccatgtggtgaccctggc
ttcagcaggagcccaagacaggtggatgggcaggcatggtcctctgagctttctgatgtt
tctcacccttggtgggaggcccattttcttttttttttttttttttgagatggtctcact
EXON 6  153 bp
tgttttgaagggcaggttcccagggtcagccagggtagggcagaacctctgattgctgca
tctctgcttacaggcccagaggcagctgctggggtgcacgaggggccttcctgctggagg
gcaggccggatggggctcaggctgtcggggtgctcacacctggtgctttggctgtcatag
GTGCAGCTGACTGCACAGACGTCACTGGGGCCTGTGTCTGACTTCTACACACTCCCTGTG
GGGATCCGCACTGTGGCTGTCACCAAGAGCCAGTTCCTCATCAATGGGAAACCTTTCTAT
TTCCACGGTGTCAACAAGCATGAGGATGCGGAC
gtgtgttggggctcctgggtccttgtcggggctgcttctggtcaccctccactttcgcct
tccctgtgtcctgcagttgagggcagctcagggcaatgaggcaaatggctccaaatggag
agggggctcatggggtggctctccagggtcctggctctcagaggaagtgcagcttcgaca
EXON 7  179 bp
cttctggtcaccctccactttcgccttccctgtgtcctgcagttgagggcagctcagggc
aatgaggcaaatggctccaaatggagagggggctcatggggtggctctccagggtcctgg
ctctcagaggaagtgcagcttcgacagggacaggggtcacttggctctgctatctcctag
ATCCGAGGGAAGGGCTTCGACTGGCCGCTGCTGGTGAAGGACTTCAACCTGCTTCGCTGG
CTTGGTGCCAACGCTTTCCGTACCAGCCACTACCCCTATGCAGAGGAAGTGATGCAGATG
TGTGACCGCTATGGGATTGTGGTCATCGATGAGTGTCCCGGCGTGGGCCTGGCGCTGCC
gtgagtctctgctgtgcacctgctccgcctgcccagcccgggggcgtcaccgtgaccctc
tgtcccttccctcctggcccgcaggcagttcttcaacaacgtttctctgcatcaccacat
gcaggtgatggaagaagtggtgcgtagggacaagaaccaccccgcggtcgtgatgtggtc
EXON 8  147 bp
cagccactacccctatgcagaggaagtgatgcagatgtgtgaccgctatgggattgtggt
catcgatgagtgtcccggcgtgggcctggcgctgccgtgagtctctgctgtgcacctgct
ccgcctgcccagcccgggggcgtcaccgtgaccctctgtcccttccctcctggcccgcag
GCAGTTCTTCAACAACGTTTCTCTGCATCACCACATGCAGGTGATGGAAGAAGTGGTGCG
TAGGGACAAGAACCACCCCGCGGTCGTGATGTGGTCTGTGGCCAACGAGCCTGCGTCCCA
CCTAGAATCTGCTGGCTACTACTTGAA
gtgagtgctccctccctgccctcggctagagtgggaaggagaccctggcaggtggctggc
ctcggtgggcatgtgctgttcaagatcggcctcgtgtccagcccaatgggaaggccgtcc
atacccagatagttcaggggaccaaatatctacccacccaaattgtggttttcttttttg
EXON 9  85 bp
ctcctgacctcaagtgatccacccacctcggcctcccaaagtgctgggattacaggtgtg
aaccatcgtgcctggccccgtgttgtgttctggcggtggaagatgggacagagaggatgg
gagggtgtctgagccattcctggactgatggaacctgtttcttctgccttttgtggacag
GATGGTGATCGCTCACACCAAATCCTTGGACCCCTCCCGGCCTGTGACCTTTGTGAGCAA
CTCTAACTATGCAGCAGACAAGGGG
gtgagcctgggggtccccaccccacttctccctgcctttgcctgggcttgtcctgaagcc
tggtcatgggaacagccaggaagaaccatgcgctgccagtctgggttttatttcattttc
ttttttacttaaaaagatagagacagggtcttgccatgttgcccaggctggtctccaact
EXON 10  177 bp
taatgctgcagtcttgctgtgttgcccaggctggtcttaagccatcctcctgcctcagcc
tcccagagtgctgggattacatcccccttaccttctctgccagaggagcccccgcagtgt
gtgaatgctgagtcatgctgtctactgagtgctgaacgggctctgctgctctggtcctag
GCTCCGTATGTGGATGTGATCTGTTTGAACAGCTACTACTCTTGGTATCACGACTACGGG
CACCTGGAGTTGATTCAGCTGCAGCTGGCCACCCAGTTTGAGAACTGGTATAAGAAGTAT
CAGAAGCCCATTATTCAGAGCGAGTATGGAGCAGAAACGATTGCAGGGTTTCACCAG
gtaagcagtgttgagctttctgcttgtgtgttctctcagggcagagatgtcactcacctc
ctccagcctgacctgcgcccactgcactgctcccctcgcttcagctttgggctctcctcc
cacggccccgtccacgttccctcaccgccaacagccaggcctgtgccccactcacttggt
EXON 11  136 bp
tttattctgggttacatcattccctggctgtctttaccccagcatcagtgagtcctgcag
tcactatagccccctgtgaagacagatattttggtcaccatcaagtggatctttattttt
atctaacatttacaattctgccagttctgactcttacattctctttgccttgaatcctag
GATCCACCTCTGATGTTCACTGAAGAGTACCAGAAAAGTCTGCTAGAGCAGTACCATCTG
GGTCTGGATCAAAAACGCAGAAAATACGTGGTTGGAGAGCTCATTTGGAATTTTGCCGAT
TTCATGACTGAACAGT
gtaagtggcagtttggctcatgggataacgtacccgtcctcattttttcaggttgccttt
ccaattctggccatttcaattgtaagaatattggaaacaaagttggggaagctggtttaa
tccatgtaggttgcgttgagaattttctaggaaaagtaagttgtgtttaggaagtaggaa
EXON 12  376 bp
ccaggaggttgaggctgcagtgagctatgattgtgtcaccgcattccagcctgggcaaca
gggagaaaaaagaaaaaaaaagacatttctatttagtgcctaccttagctccagactggt
tctaacttgacccatcagaagacatctgaatcgctttgtgtcttttttttttttttgtag
CACCGACGAGAGTGCTGGGGAATAAAAAGGGGATCTTCACTCGGCAGAGACAACCAAAAA
GTGCAGCGTTCCTTTTGCGAGAGAGATACTGGAAGATTGCCAATGAAACCAGGTATCCCC
ACTCAGTAGCCAAGTCACAATGTTTGGAAAACAGCCTGTTTACTTGAGCAAGACTGATAC
CACCTGCGTGTCCCTTCCTCCCCGAGTCAGGGCGACTTCCACAGCAGCAGAACAAGTGCC
TCCTGGACTGTTCACGGCAGACCAGAACGTTTCTGGCCTGGGTTTTGTGGTCATCTATTC
TAGCAGGGAACACTAAAGGTGGAAATAAAAGATTTTCTATTATGGAAATAAAGAGTTGGC
ATGAAAGTGGCTACTG
aaaagcatctgaaatcatttctgtgcgtcgtgctgttttcagagctttaactgtgtgtgg
acttttgagaaactgctgctccaacacccccaccacgttcagagcagctggttcccgagg
gcgtctgcaggaatagccccatggtcctagggccaccgtgtttgtgtagcaaaccaggcc