Gene GPR146 Variant 1
DNA : 1.76 KbNT_079592
mRNA : 1757 bp NM_138445
CDS : 1002 bp NP_612454
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1757 bp
tttttcaacgctcaacttcactttcacagaaatgcaccaaaggcagcctcgctctgtggt
ctgcagcgattactgcaccaggagaaggcacccctgtacctgcagcacttctgggccagg
gctttgggacgggacgcgagctgaccacctgttccttctttccgcagggtcgcggagcct
CGCCGGCCGCCATGTGGAGCTGCAGCTGGTTCAACGGCACAGGGCTGGTGGAGGAGCTGC
CTGCCTGCCAGGACCTGCAGCTGGGGCTGTCACTGTTGTCGCTGCTGGGCCTGGTGGTGG
GCGTGCCAGTGGGCCTGTGCTACAACGCCCTGCTGGTGCTGGCCAACCTACACAGCAAGG
CCAGCATGACCATGCCGGACGTGTACTTTGTCAACATGGCAGTGGCAGGCCTGGTGCTCA
GCGCCCTGGCCCCTGTGCACCTGCTCGGCCCCCCGAGCTCCCGGTGGGCGCTGTGGAGTG
TGGGCGGCGAAGTCCACGTGGCACTGCAGATCCCCTTCAATGTGTCCTCACTGGTGGCCA
TGTACTCCACCGCCCTGCTGAGCCTCGACCACTACATCGAGCGTGCACTGCCGCGGACCT
ACATGGCCAGCGTGTACAACACGCGGCACGTGTGCGGCTTCGTGTGGGGTGGCGCGCTGC
TGACCAGCTTCTCCTCGCTGCTCTTCTACATCTGCAGCCATGTGTCCACCCGCGCGCTAG
AGTGCGCCAAGATGCAGAACGCAGAAGCTGCCGACGCCACGCTGGTGTTCATCGGCTACG
TGGTGCCAGCACTGGCCACCCTCTACGCGCTGGTGCTACTCTCCCGCGTCCGCAGGGAGG
ACACGCCCCTGGACCGGGACACGGGCCGGCTGGAGCCCTCGGCACACAGGCTGCTGGTGG
CCACCGTGTGCACGCAGTTTGGGCTCTGGACGCCACACTATCTGATCCTGCTGGGGCACA
CGGTCATCATCTCGCGAGGGAAGCCCGTGGACGCACACTACCTGGGGCTACTGCACTTTG
TGAAGGATTTCTCCAAACTCCTGGCCTTCTCCAGCAGCTTTGTGACACCACTTCTCTACC
GCTACATGAACCAGAGCTTCCCCAGCAAGCTCCAACGGCTGATGAAAAAGCTGCCCTGCG
GGGACCGGCACTGCTCCCCGGACCACATGGGGGTGCAGCAGGTGCTGGCGTAGGCGGCCC
AGCCCTCCTGGGGAGACGTGACTCTGGTGGACGCAGAGCACTTAGTTACCCTGGACGCTC
CCCACATCCTTCCAGAAGGAGACGAGCTGCTGGAAGAGAAGCAGGAGGGGTGTTTTTCTT
GAAGTTTCCTTTTTCCCACAAATGCCACTCTTGGGCCAAGGCTGTGGTCCCCGTGGCTGG
CATCTGGCTTGAGTCTCCCCGAGGCCTGTGCGTCTCCCAAACACGCAGCTCAAGGTCCAC
ATCTGCAAAAGCCTCCTCGCCTTCAGCCTCCTCAGCATTCAGTTTGTCAATGAAGTGATG
AAAGCTTAGAGCCAGTATTTATACTTTGTGGTTAAAATACTTGATTCCCCCTTGTTTATT
TTACAAAAACAGATGTTTCCTAGAAAAATGACAAATAGTAAAATGAACAAAACCCTACGA
AAGAATGGCAACAGCCAGGGTGGCCGGGCCCTGCCAGTGGGCGGCGTGTGCTAGCAAGGC
CTGCCGGGTGTGCCGCAGTCACCACAGGGTTCTGAGAACATTTCACAGAAGTGCCTGAGA
CGCGGAGACATGGCTGGTGTTAAATGGAGCTATTCAATAGCAGTGACGCGCTCTCCTCAG
CCACCAAATGTCCCTGACACCCTCCCCAGCCCCCACAGATAACATCAGCTGAGGTTTTTT
TCAGTATGAACCTGTCCTAAATCAATTCCTCAAAGTGTGCACAAAACTAAAGAATATAAA
TAAACAAAAGAAAGGTG
tgttaggatttctgactgaataccagagctgaagggcccccaggggacagagggctggag
gctgtgtcacacggggtctggtgggagggccagggtggaaccttaggccagctccgaagg
cacctgggaccagcatccgtatctccgcggccctcgcagcctcagatggggcccggaccg