Gene GNA12 Variant 1
DNA : 112.95 KbNT_079592
mRNA : 1146 bp NM_007353
CDS : 1146 bp NP_031379
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  309 bp
ggcccgagtggcggccgggcgacgagtgcgggcctcggagcgactgcagcggcggcggcg
gacgcggcctgaggcgagcggcggggcgtggggcggtgcctcggcccgggctcgccctcg
ccggcgggagcgtccatggcccccgggcgccggcggggcgcggccgcggcctgaggggcc
ATGTCCGGGGTGGTGCGGACCCTCAGCCGCTGCCTGCTGCCGGCCGAGGCCGGCGGGGCC
CGCGAGCGCAGGGCGGGCAGCGGCGCGCGCGACGCGGAGCGCGAGGCCCGGAGGCGTAGC
CGCGACATCGACGCGCTGCTGGCCCGCGAGCGGCGCGCGGTCCGGCGCCTGGTGAAGATC
CTGCTGCTGGGCGCGGGCGAGAGCGGCAAGTCCACGTTCCTCAAGCAGATGCGCATCATC
CACGGCCGCGAGTTCGACCAGAAGGCGCTGCTGGAGTTCCGCGACACCATCTTCGACAAC
ATCCTCAAG
gtgacgcgcgccccccgcccagcacctgcacccaggtgggccggggcgctaacccccgcc
ccgggcccctccgtggtccgccgccgcgggcggggacccctggggcgaggatgctggatc
cagccccgcctgcaccccactcccccccgacccattccccgaggcctgctggcgtcgtct
EXON 2  216 bp
ctgctgagagttaagactttccacatcacaacaaacaaaccaagagacagactcaggctg
cacagctcagagcttgtgagttttctgcgttatgacaatggatgcccattttgagcttct
ctagcgtggtttagtctttggaatgcaattaaatcctctcttctttcttttattttctag
GGCTCAAGGGTTCTTGTTGATGCACGAGATAAGCTTGGCATTCCTTGGCAGTATTCTGAA
AATGAGAAGCATGGGATGTTCCTGATGGCCTTCGAGAACAAGGCGGGGCTGCCTGTGGAG
CCGGCCACCTTCCAGCTGTACGTCCCGGCCCTGAGCGCACTCTGGAGGGATTCTGGCATC
AGGGAGGCTTTCAGCCGGAGAAGCGAGTTTCAGCTG
gtgagtgagtaggccttcttgctgggcacctgatagtgtgttttttacatgactattttg
gaccgttagttgaatttccttaaaaactgtgtaacagtccaagcaagctctaaatcaccg
taagttgtaatgatcaacaaccaaaacacgggatggaggcagatgctatataaaaggctc
EXON 3  51 bp
tttctttaatggtagtttttttattttagaaaacacacggacactctctgcctttttcct
ttgctttcccattcacacggaggcgaaatgccactgctcttaccctgttcagttcttgta
tttgccacatcaggattcctcagtccagactgagctgtgaatattcttccttcctgacag
GGGGAGTCGGTGAAGTACTTCCTGGACAACTTGGACCGGATCGGCCAGCTG
gtgagtaagcacgcccgcccgaagaagctgggctccagggttagaaaacatgtgtccaga
gaccaaagcagtccacgttgtgaggactttggctggactgacaggccgagcttgttctgt
cacattaccacgaatagtactgtaatggcacgctctcacttggatctgggccccgtctca
EXON 4  570 bp
gattctttctgtttcacggccagttgataatgttataaatgaaatttgcttttggtttct
ggttcaacctgttgcaaaagtcagtctctttccttcttatctttttgccatctttttgtt
tctattttctctgttctttcttcctccccctaaatttctgcctcatcctgtattttacag
AATTACTTTCCTAGTAAGCAAGATATCCTGCTGGCTAGGAAAGCCACCAAGGGAATTGTG
GAGCATGACTTCGTTATTAAGAAGATCCCCTTTAAGATGGTGGATGTGGGCGGCCAGCGG
TCCCAGCGCCAGAAGTGGTTCCAGTGCTTCGACGGGATCACGTCCATCCTGTTCATGGTC
TCCTCCAGCGAGTACGACCAGGTCCTCATGGAGGACAGGCGCACCAACCGGCTGGTGGAG
TCCATGAACATCTTCGAGACCATCGTCAACAACAAGCTCTTCTTCAACGTCTCCATCATT
CTCTTCCTCAACAAGATGGACCTCCTGGTGGAGAAGGTGAAGACCGTGAGCATCAAGAAG
CACTTCCCGGACTTCAGGGGCGACCCGCACAGGCTGGAGGACGTCCAGCGCTACCTGGTC
CAGTGCTTCGACAGGAAGAGACGGAACCGCAGCAAGCCACTCTTCCACCACTTCACCACC
GCCATCGACACCGAGAACGTCCGCTTCGTGTTCCATGCTGTGAAAGACACCATCCTGCAG
GAGAACCTGAAGGACATCATGCTGCAGTGA
gcgaggaagccccggggtttgtcgtcgttgagcagcccccacggctgtcggtcagactct
tgggtgtgtgttgtctgtgtggtccttgagtgggtttctcggatccgtgccctggaatac
ctggctcaggaatgctgtcagaccagccagccagcgagctctaggcaaaaggacatggaa