Gene GARS Variant 1
DNA : 39.46 KbNT_079592
mRNA : 2745 bp NM_002047
CDS : 2058 bp NP_002038
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  579 bp
atgtgtgactctgggcaaatcattaacctctctgggcctatttccttatctggggaacat
ctgcacttgagcaacagaagtctaagatccctatctgatttgatgttttgcgaccctttt
aaggcgcagggcgcgaaagaacagaaacagaagtgtccgttcaagtaggtcggccggggt
GTCACTCGTATAAAAACCTATGCTTTGAAGGTTCTCGTGTGTCTCGGCCTGCAGGTCTCG
CTCAGAGCTGTGTCCCTGAACATCCACCCTGCTGGGGTGGCTTGACGCACTTCTGTGCAA
ATCTGTTCGCTCGCAACCCTACCTACCTCTCTCCCGAACCGGAGAAAACCTTCGGCGGGG
TCCTTCCGGGTTTTGTGTCGAATCTGCGGCGGCGACCCGGCGCCGCGTCACGCGGTGGTG
AATGTGCGGCAGCACGCGCGCCGCGTCGTTTACGCGGCGATTTCATCATGCTCCGAGCCG
GGCGGCGCGCGCCGCTTCCGTCGCCACCCTCTCTGGACAGCCCAGGGCCGCAGGCTCATG
CCCTCTCCGCGTCCAGTGCTGCTTAGAGGTGCTCGCGCCGCTCTGCTGCTGCTGCTGCCG
CCCCGGCTCTTAGCCCGACCCTCGCTCCTGCTCCGCCGGTCCCTCAGCGCGGCCTCCTGC
GCCCCGATCTCCTTGCCCGCCGCCGCCTCCCGGAGCAGCATGGACGGCGCGGGGGCTGAG
GAGGTGCTGGCACCTCTGAGGCTAGCAGTGCGCCAGCAG
gtaccggtgttttgcgctctccgctaagcctccggctctcctcccagggccttcttctgg
tcatccttccctcctccccggggaactgtcctcctcttcggttacccctttctttccctt
catcctctggcgtcttcttcgcctcccccactttggtcccaagtcccccgtgcgtcagcc
EXON 2  102 bp
tgatctcagatggtgaggagggcctttcaaagtgctggtattacaggcgtgagccaccac
gcttggcctgaattgcatcattcttacatagactttttaaaaggcacgcttaaaaacaca
ttcctaacatttcttaacttctgaaaccaatcctgaatataaattctctttcttggctag
GGAGATCTTGTGCGAAAACTCAAAGAAGATAAAGCACCCCAAGTAGACGTAGACAAAGCA
GTGGCTGAGCTCAAAGCCCGCAAGAGGGTTCTGGAAGCAAAG
gtgagtcctgggatgctaaaataggaacataagtaggtataggattgttcatctttaatt
tctttggatgggagagacctagaaaagtttctgaacaagtatcatttggtttatctgttt
atccataatgccgccttctcctttccctctacctggtagactcctcatcctttcaaaatg
EXON 3  103 bp
tttatattactcaaagggaaaaaaagacctatggcttctattgtttttaacctatcaaaa
tcttgtctgtttgataaattttatatttaattctggtgaggaataaactaaattcagata
tataagttcagattcccacccacccctccactcactcactttttatttaatctctaacag
GAGCTGGCGTTACAGCCCAAAGATGATATTGTAGACCGAGCAAAAATGGAAGATACCCTG
AAGAGGAGGTTTTTCTATGATCAAGCTTTTGCTATTTATGGAG
gtaagggattaatgacaaaaagaactattgtgttgttagtggctctaatattatacttaa
atcaagaacatggcttgcctgttggtatccacttgtatcaggccacaaagcagaggatgg
atgttttgcttttgtttgcttggagtcaccatttggtgtgatacctgttatttttctcca
EXON 4  142 bp
gagcttttttattttacttccatcagctagctgaaagtaaggttcttcagtattgaggga
tttgcattgttgacttgaatacacttttagggagtataggtatcagtttctcatgtctcc
ttgccttcatttgttcagagtaacaaggtaaagtatgtgttttcctctcatattctatag
GTGTTAGTGGTCTGTATGACTTTGGGCCAGTTGGCTGTGCTTTGAAGAACAATATTATTC
AGACCTGGAGGCAGCACTTTATCCAAGAGGAACAGATCCTGGAGATCGATTGCACCATGC
TCACCCCTGAGCCAGTTTTAAA
gtgagatcttactttggagtgggggtatcctactttaaataaaataacttattaaattat
ttaatatacttatctaaataacttcctgattataaagaactactcatttcatgtagaaaa
tctgaaaaatatggaaaagcaaagaaatgtataccttctgctcacagatagctatgttaa
EXON 5  89 bp
tagatttgaggaagaattttctctggcatacattactgtcatggatacatcattactata
gatatgggagcttccatctttgagatggatataaatattgatggggaattatcttataag
gtaatatctatgtgtaatttgtatgagaatgacaaattgggttggcatttgttaatttag
GACCTCTGGCCATGTAGACAAATTTGCTGACTTCATGGTGAAAGACGTAAAAAATGGAGA
ATGTTTTCGTGCTGACCATCTATTAAAAG
gtgaggttcttcatctccttcaggtaggattgatcaaaataaaaggtttaaactttctct
cagatgtctttcattaaattttttattgaggcataacattcaaagagcaaagtgcacaga
tcttaagtatatagatcaagtcctttattttttaaaaaagttatatgtagataattagtt
EXON 6  77 bp
ttttctaattagcaaatgaatcaagacaataccatgactgctgttgtaaaatcaactgtg
ggattcatgtaaattaagaactttatgcttggatttactttttaattgtctagcattgaa
actgaaaagtgcattgtactttttcccattgattgatatatgtcaacactgttcttacag
CTCATTTACAGAAATTGATGTCTGATAAGAAGTGTTCTGTCGAAAAGAAATCAGAAATGG
AAAGTGTTTTGGCCCAG
gtgagtactctagagatgttatcagagtaacctaggtggtcgctgtccttctttcagtgt
ttaatgactgttgcatttcccattatgctgaccctggccacattgtaatgaagcagaggt
taattctgtcctgtatagcgtctctttttttgcatttttattttcttctctcttttgtga
EXON 7  146 bp
aatggaaagtgaataaattggttatggttttaatgtgggtgtcctgaaggttaggttaat
tgtgatgttcctgaattttgtgtgattgtagcagtggatggctagggttatatataatac
tttatatcttatgccttgttttctctgtcttttacactaatttctttatatgtcttttag
CTTGATAACTATGGACAGCAAGAACTTGCGGATCTTTTTGTGAACTATAATGTAAAATCT
CCCATTACTGGAAATGATCTATCCCCTCCAGTGTCTTTTAACTTAATGTTCAAGACTTTC
ATTGGGCCTGGAGGAAACATGCCTGG
gtatgtatcacttattgtttacctgtttatgtaatgaagtttttaaaattgcttatatta
aaaggtaaatatcaatgttatgaaggaaaaatttttaaaaagtgatatacagaagtacag
atgaatgtattatggagaaataatggcagaaataaatcttttaaaaaattctttctgaat
EXON 8  150 bp
acgtgctatgaaaatgtttgctaccgaggaaaatatttctaaaacttcattttagggcct
gttcaactttgttgtgaaaatggtatatttaggacttttaggatttgtatctagaatttc
aggattgttggaaaacataatttctttctttgtaacagactgacttacttaaatttatag
GTACTTGAGACCAGAAACTGCACAGGGGATTTTCTTGAATTTCAAACGACTTTTGGAGTT
CAACCAAGGAAAGTTGCCTTTTGCTGCTGCCCAGATTGGAAATTCTTTTAGAAATGAGAT
CTCCCCTCGATCTGGACTGATCAGAGTCAG
gtactgctcaggttactcttacaaattagtgaatgaccttggcattgcattgaaaatgaa
agcttgctgttttgaaacaattctgcttcataatcctgattatgaatttatttttgtttt
ctccaaaaatcatgttttacatttggaatctctaaatgtaatctccaggatgacaggcag
EXON 9  163 bp
tttaattcaaaatttttttggccattcccttaggaaaccaactttctgtttagtgaaaaa
gaccactatagtatggagcctttatcactagaatgcagttgaaaatagaggccttgtttt
ttgtttgtttgttttttgtagttaaatatgcaggtttatcgcttacgtttttgctttcag
AGAATTCACAATGGCAGAAATTGAGCACTTTGTAGATCCCAGTGAGAAAGACCACCCCAA
GTTCCAGAATGTGGCAGACCTTCACCTTTATTTGTATTCAGCAAAAGCCCAGGTCAGCGG
ACAGTCCGCTCGGAAAATGCGCCTGGGAGATGCTGTTGAACAG
gtaggattctggaggtaacttaacttagattgtgcctgttcagggtttgcagcaattagc
aaattctatgtgttctgggtgacaagatattttattttggcagtcatttgcttttttaca
gtacttggttttgtacagaatttgttatacagtattattatagtaagagaaaaatcacct
EXON 10  165 bp
aaataaccaagatctcattctgagtatttgaaattgttttgaaagcaagataaaatagtt
tgtgttgggtgtcaaatatttttcagtagagtgagtcaatggaaaccgatatcttggctt
tgaagagtattaatgtgtgttttcttttcttcctccatgcttgcttattggttggtttag
GGTGTGATTAATAACACAGTATTAGGCTATTTCATTGGCCGCATCTACCTCTACCTCACG
AAGGTTGGAATATCTCCAGATAAACTCCGCTTCCGGCAGCACATGGAGAATGAGATGGCC
CATTATGCCTGTGACTGTTGGGATGCAGAATCCAAAACATCCTAC
gtaagtggagtgctgtttaccatgtgattttcacattgttaacttagaagcacaggtacc
aaatgaatttttgtgcactttatgtcacagaggaacaaagggaaaagaaaagagatcttt
tcctgagcaaaacagaaaaagcagttgcctcctgcctttttataagtgtcctaaggagct
EXON 11  108 bp
tattagctgcctgatatatgaggctattcccatttcaaatatttatgaaatttgaatgaa
gattatatcatcgaattatcattgaatatatgaaaggtttataatctgcatgcatttgtg
aatgaacccaatataagtaataataagtaagtaatgtttttattgattatatctttttag
GGTTGGATTGAGATTGTTGGATGTGCTGATCGTTCCTGTTATGACCTCTCCTGTCATGCA
CGAGCCACCAAAGTCCCACTTGTAGCTGAGAAACCTCTGAAAGAACCC
atatcctttctggtcactccaaaaactcaggattcacatgtgaacatcttgctaatgaat
aagtccaagtctttaccttgttctatggataaatggagatgttttagacactgtagtaac
gcttgtttaaacctattattttacctatccctttgttcctttcctattctctgtacttgt
EXON 12  146 bp
gagttgtctgaatgattttgtggacaggtgtttcatcttgccttaaaatcagcataaaca
ggatctggagtactgatagagagctggcatggttttaagttgatgattgattgttctcag
gctcattttctgaaatactgaggcagtgctgtagttttggattccttgactacttcatac
AAAACAGTCAATGTTGTTCAGTTTGAACCCAGTAAGGGAGCAATTGGTAAGGCATATAAG
AAGGATGCAAAACTGGTGATGGAGTATCTTGCCATTTGTGATGAGTGCTACATTACAGAA
ATGGAGATGCTGCTGAATGAGAAAGG
gtaagatatcagatgtttactcttccatgggctccagtcagttgtgtcatctgccaggtt
ctgaaaggatgagattaatttcttaagattttttgcaggtaagtactgtatcttggctgc
atttaaaagactgtctttgccgagattttggcattatagcctgaaaaaagatttgaaata
EXON 13  86 bp
gactaatgcttaatttggtgtttcttatgaaataatttaaatttgacatcacttattata
tctggagagttgatcaagttataaaaagaaaaaacaacttagcaatctacaaaattcctt
taaattaaggcacagggtgcctgtttgaactaatacaaaatgtgttttgtttcttcgtag
GGAATTCACAATTGAAACTGAAGGGAAAACATTTCAGTTAACAAAAGACATGATCAATGT
GAAGAGATTCCAGAAAACACTATATG
gtaaatttgtaaaaataataaacaaaaagtcactgctccttaaagcttttgttgttgttt
gagacagggtcttgctctgtcacccaggctggagtgcagtggcacaacctctgcctcccc
ggctcaagcgttcctccctcctgtctcagcctccgaattagctgggactacaggtgcagg
EXON 14  110 bp
tcaccatgttggtcaggctggtctcgaactcctgacctcagatgatccacctacctcagc
ctcccaaaatgctgggattacaggtgtgagccaccgcagctggtgaattgtttagagaga
atctgaaatgcattatgtggtatttgagagaatgttattgaatttctatctctttttcag
TGGAAGAAGTTGTTCCGAATGTAATTGAACCTTCCTTCGGCCTGGGTAGGATCATGTATA
CGGTATTTGAACATACATTCCATGTACGAGAAGGAGATGAACAGAGAACA
gtaagttgttgtgtacagtgtgctgttatagtgtcagaaaataaaaattttctgaattac
attgtgaagtacattaataagactctagaatggtcaattagttattactataatctagtg
ctattaacactcatctttgcttaagtatgtatagacaaaccagtttcctgtgttatctta
EXON 15  94 bp
tctgatgctggttctgcttctcttttgccatactgcttttcatgtcatgttttctggcat
tttggtaatgacgttatgcttgaacacttgctgaatattaacctcttttggtttgggata
ttagcatttagatatttacaaattaacatatttggatttttttctttttaaatcatccag
TTCTTCAGTTTCCCTGCTGTAGTTGCTCCATTCAAATGTTCCGTCCTCCCACTGAGCCAA
AACCAGGAGTTCATGCCATTTGTCAAGGAATTAT
gtaagcaaattcaattgggtaaactccatgggaacaccatcaaggagactgaattttagg
aaatgtatcatttatttcaataaaaatatagactgaataaagaatataaatgattttata
aagagtacatgattttagcctgtactcttatttctaagcgagaggatatgcttgctcaga
EXON 16  191 bp
ttggattcccgcaagggatttattaaactttagggatatttctttctcttgcaactcaac
ttgttgctttcttgtcttggtcccatttataagtctcctgagcttgtaagacagtagtta
gataacactgggcttaactccattgttttatttttaatttactttgtttattttggatag
CGGAAGCCCTGACCAGGCATGGAGTATCTCACAAAGTAGACGATTCCTCTGGGTCAATCG
GAAGGCGCTATGCCAGGACTGATGAGATTGGCGTGGCTTTTGGTGTCACCATTGACTTTG
ACACAGTGAACAAGACCCCCCACACTGCAACTCTGAGGGACCGTGACTCAATGCGGCAGA
TAAGAGCAGAG
gtatctggccttctctttggcatttttagccttagaaatgtgtactgcttcttactgatt
tgtgttggattttgatgtgtttatgctccctttcctttttttttctttttaattttaatg
aacggcttgtatcagacagagcccagattctcaagtcccccggtttaattatgaaaatat
EXON 17  294 bp
ttgtggcagaattgagttgtctgggggaactggtgggcgttttgggctagaagagcatga
acccatgcctggcatgacattgtttggctctgtgtaaggtttcctgagttcaggatgaat
cttcttcttaaaaatctgaacaagttggttgatacttggcttctctttccttgtctctag
ATCTCTGAGCTGCCCAGCATAGTCCAAGACCTAGCCAATGGCAACATCACATGGGCTGAT
GTGGAGGCCAGGTATCCTCTGTTTGAAGGGCAAGAGACTGGTAAAAAAGAGACAATCGAG
GAATGAGGACAATTTTGACAACTTTTGACCACTTGCGCTAATAAAAAAAAAAAAAAACTA
CTCTTATGTCCACTTTACAAAAGAAAACAGCATTGTGATTACTCCCAGGGACCGTATTTT
ATCTTCAGTGGCTGCCTGATTTTACCCCCACAATTAAAGTTGAAGGAATCCTGA
acaaacttgtgatctatttgcttgtgtttttacattttcagcaaggctgtttctcccacg
tttgggtagacatgctcatggcttaatgttaaacacagttaacactttttaaaaaattaa
cagctttattggggtgtaatttacataccataaaaatagcctgtcttaagtgtacagttc