Gene FKBP6 Variant 1
DNA : 30.26 KbNT_079593
mRNA : 1491 bp NM_003602
CDS : 984 bp NP_003593
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  119 bp
gatcatacctcgcacctcaccgcgtggcctctgtagttccagagctcgcgagggccaggg
ccgttggcggcggttggaacgaaacgatgagtgcctcctcgtggccccagaatggaatgc
cgccgtcggtaggggtctgccgggcataaaggggccttcggaaccccaccagagtcacag
CCAGGGAGGGCAGCGGGGCGCACCAGGCCGAAGGCTCACGCCACAGGGAGGGCAGCTAGG
ACATGGGGGGAAGCGCGTTAAACCAGGGAGTCCTGGAAGGGGACGACGCCCCCGGCCAG
gtgagggcccagacgtttcgggggcgtagacgctgaggggtggccgggtgggtctgcggc
tctgaggcctggctttcattctccatcagtccctgtacgagcggttaagtcagaggatgc
tggacatctcgggggaccggggcgtgctgaaggacgtcatccgagaaggagctggagacc
EXON 2  118 bp
cgaaggctcacgccacagggagggcagctaggacatggggggaagcgcgttaaaccaggg
agtcctggaaggggacgacgcccccggccaggtgagggcccagacgtttcgggggcgtag
acgctgaggggtggccgggtgggtctgcggctctgaggcctggctttcattctccatcag
TCCCTGTACGAGCGGTTAAGTCAGAGGATGCTGGACATCTCGGGGGACCGGGGCGTGCTG
AAGGACGTCATCCGAGAAGGAGCTGGAGACCTAGTGGCGCCTGATGCTTCGGTGCTAG
gtacgccctggggcggtttgtcctcaggatccatgtcatcgcactctgttgggaagagag
aggcctcattttcaaaaagcacttaatggggttggaaatgctttgtttgaagtggatttt
tgttttttgtttttgaaacggggtcttgctcagttgcccaggctggagtgcagtggtgcg
EXON 3  90 bp
cctctgagccaaagggccggcacccaaaatgcagagagaagatttattcctgtacctcgg
ggtgtcgggcagcttaagctcatctgttcacattgtttctgtgtgatcatgagagactcg
atattatggtggcgtgggtgtttttggtccattttccttacattctttcttctatcctag
TGAAATACTCGGGATACCTGGAACACATGGACAGACCCTTCGATTCTAATTACTTTAGGA
AAACTCCTCGGCTAATGAAACTTGGAGAGG
gtaggttcagagtgggagctggagaagaaggaattgtttaggggctagatgaggcacgat
gcctcaggctgggaagactgctcagagcgcaggttctttgagttggctttgctgaggctg
ggttttggtaacacagccatgttctctccccttgagacctaggcatttgggagatggctt
EXON 4  203 bp
aataaaatttctatcagtagaagctgggcacaggctcaggaggaagacattgcaggaaga
gggaactgtgtgagggagacatggaggccagagtactgctgacttagagggggaagaaac
tgatagcactgagcaggatactgagcaagcttcacccaccttctttgtccattcttacag
ATATTACACTGTGGGGCATGGAGCTGGGCCTTCTGAGCATGCGGAGAGGAGAGCTGGCCA
GGTTTCTGTTCAAACCGAACTACGCCTATGGAACGCTGGGCTGCCCTCCCTTGATCCCCC
CAAACACCACTGTCCTGTTTGAGATTGAGCTGCTTGACTTCCTGGACTGTGCTGAGTCAG
ACAAGTTTTGTGCTCTCTCAGCT
gtaagttccagagcacagatgtcagcactttatagagagacgaatgggttggtgttattg
gtaattcttctagatggcctgccctgaggctgatcgtcctctccagggtacccccgcggc
tcctgtgcggtggcggcggagttcctctgcttcctagtctgtgtttgtcttagtaatggc
EXON 5  120 bp
agagctcacagctgtagtaacacttcctttctttcaattactatttttttaaatggagac
atgttctcactatgttgcccaggctggtctcgaactcctgggctcacgtgtactaacact
tccattgtggcattactgcttttggtttccttgctgaatattcctgtctctggtcctcag
GAGCAGCAAGACCAATTTCCACTTCAGAAGGTCCTGAAAGTGGCAGCTACGGAACGGGAG
TTTGGCAACTACCTTTTCCGCCAGAATCGTTTCTATGATGCCAAAGTGAGATATAAAAGG

gtgagaatgctttgaaagttaagtgtaagtttagatcctgaaaacttccttgtttaaaaa
acacagattttgttttgttgtgatttttgttttgttttgtttttgagacaagagtgtcgc
tctgtcgcccaggctggagtgcagtggcgcaatctcagctcactgcaagctccgcctcct
EXON 6  195 bp
aacaagactccgtctgaaaaaagaagaaaaaagaaatatacctgacttcttatgttgatc
ttgtgtcttgcaacctgtaacagccgatttttagctctgatagtttttgcgtgtggattc
tttagggttttgtacataagactgttactcctcttgaccatctgccttccctctccacag
GCCCTGTTGCTTCTGCGCCGGCGATCAGCACCCCCTGAAGAGCAGCACCTGGTGGAGGCC
GCCAAGCTTCCTGTTCTCCTGAACCTGTCCTTTACATACCTGAAGCTAGACCGACCCACC
ATAGCCCTGTGCTATGGAGAGCAGGCTTTGATCATTGACCAAAAGAATGCCAAGGCCCTC
TTCAGGTGTGGACAG
gtgagttggaagccagtgacttgggaataaacacccaggaaaaggtagtagcagtgctca
actcagctactgcaaaaatgctgtctttttttttttttttttttttagacagagttttgc
tcttgttgcccaggatggagtgcagtggcgcaaattcggctcgctgcaacctccgcttcc
EXON 7  110 bp
tttgtagttttagtagagatagggttttgccgtgttggccaggctggtctggaatccctg
acctcagttgatccgcccgccttggcctcccaaagtgctgggattacaggcatgagccac
cgtgcccagccaaatgatatcttttctaactgtgcttttaaagttctctccttgggacag
GCTTGTCTTCTCCTGACTGAGTATCAAAAGGCCCGGGATTTTCTAGTTCGAGCCCAGAAG
GAGCAACCCTTCAATCATGACATCAATAATGAGCTGAAGAAACTGGCTAG
gtgagctgtgtttgcaggagcatgaagagagatgggtggggttgtgactctggtctgtcc
ccccaccccccccaacaaaggacagtctggcggtgttgcccagagtgttaggaggccgcc
ccctctacagctgggtttttgaagtgctcggccgtgcgctgcaccagcagttcccagcaa
EXON 8  93 bp
gccagctgtgggagccttccctgcctccccacctctccagcttacttccatccctcccaa
ctcagtttgagtcctgataaattttcagtgtttctggatgtgagtggagaattccagcca
ccagatgtcacctcctccaaacacagacctcctctaacgagtgtgtatttccctctccag
CTGTTACAGGGACTATGTGGATAAAGAGAAAGAAATGTGGCACCGCATGTTCGCGCCCTG
TGGCGATGGTTCTACAGCAGGAGAAAGTTGAAG
gtaatcaaagggccagggtggcacacaggcttccggatggagaagcgtgctgctctcctc
cacccccaagtgaatggtggctgtctgcagctgagggtggacgaggggtagacaagttcc
ttgctgtaaagaacaacacaacggtagtgcaggatgcacgtgctgcacgcctacctttcc
EXON 9  443 bp
aggtttcccagagcccatctagtagggccacacggtgatggcatctgtctcttggctcct
gtgtggtcaccggccatgcccttccctgacctcagctgctagccctcagcacatgtgact
gtgacgtcgtgtggcagctgctgagtcctgagatgtttttaatggctgtttgattcccag
GTTCTTCACCTACCAACGAGGGGAGAGAGCTGTGGTTCTCCATCATTGGGGGAGTGGAAG
GGAGCTCCCAGCGCAGCCGTGGCAGCCACCTTCCAGGAGCAGGGGCTGGAATGTCCTGTG
GCCGCATCTCTCATGGACGCGGCTGAAACGTGTTTTCACAGGTGCTGTTTTCTGTTTTCC
GTGTTCGTAACAGAAGGGAGGGGAAAGCGCAGCTACTGACAAGTAGAACACTGCTACTTT
TTTTAAGGCAGTTTCTTGTTTTTTTAGACGGAATTAGTCCTTGGCTTCCCTCCCAGTCCC
AGCCCTGCTTCCGGCTGCGAATGTCCCTGAGTCAACACCAATAGAGATTGCTTTGTGTAT
TTTGTAGGGTTCTCTGTTTTGAAGACAGAATTATGTTACAAATGTTTTTGTTGTAAATAA
ATAAAACACTTCCTTGTCCTTGC
aagatccagtataagtgaattgcgtggactcagctaagcttccagagtccccaggtgggc
agggggaggccatttgccagtggggctggggctcaagctctggagccagcggttctgatt
cacctgataacgaaacgctgcacaccaggcttggggttccctaagcccgctcccagtgtg