Gene FAM3C Variant 1
DNA : 47.41 KbNT_079596
mRNA : 2459 bp NM_014888
CDS : 684 bp NP_055703
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  126 bp
cctccctccgctctccggcccttccctctggccggcccgggcgcccgcttggtcctccac
cgccagggggcgggcgcggcttcccggcggcgggggcccattggtcgcggccgggaagcg
tgggaggaggcccagcggcgagctggctttctcctggccacttgccggggtgaggggcag
CCGGAGGAGTCCGAGAGGAAGCGGAGGCGCGAGCTGGAGGCGGCGGCTCCCGTCGGCCTC
CGGCAGGACTGAGCGCTGGGAGGCCGGAAGGCGGGCGCGCGCGGCGGAGAGGCGGGCGGG
AGGCCG
gtgagacggctgggaggcggacggagccggggctcaggttcggggagggatggaggaggc
cggggaagccagacgcccacctacgacttcagcctccgcgcactgcggtcaccggccggg
ggcgggccccgggcccggccgcgttgtcacggcgtgtccggacgttggagagggcgcagg
EXON 2  54 bp
ttgaggtcttatggtccagtggaagacaggcccattttttttttttttaatgccaatgtt
ggcataatacttagaaatgtcataaaatttactagtttatatgccccatttcaaactcaa
tctaaggaggaatgtttgctctagagctaatgatatttgctttttgttttgattttttag
GAGCATATTAATGAAAAGTGCCATAAACTGAAAAACCAAACATGAGGGTAGCAG
gtaagatatttaatttagtagaagtaattgtactttttgtgtaacctgtttgttaaagaa
taactaaaggagaggttaaataatctttatattgagaaggttaaactgaaataaactaaa
tcattcagccctttgtttttaggtagttggcaaatcacaaattggacatttagtcagtat
EXON 3  105 bp
aattctttatcttgatgaattgtttgtataatttttatgtatctcatgtaaaattaagat
ctaatagatacaaagtagaaatgtattgatcttaaaaaatttataaacatttttcataga
aatgcaaaataaaagttctgtgggcttacaaagttatgctgaaatacttctgccttttag
GTGCTGCAAAGTTGGTGGTAGCTGTGGCAGTGTTTTTACTGACATTTTATGTTATTTCTC
AAGTATTTGAAATAAAAATGGATGCAAGTTTAGGAAATCTATTTG
gtaagttttatttttttcctttcttaaatcttatttttgatgtggcctaaagttttatca
gttatcagcactgagtcactcagtgctagaaaacgaaatgtgattattatatatccataa
atatgatttgttagaatattttacagtatataattagatattttggaattaatttagtat
EXON 4  30 bp
agtttataatgaatgtacagtgtgaagttactttctcactttttcttaagtgatattcat
gttttattgtatactgaatcattatttgaacacttatttttgtggacctaaatatatttt
aaaagtggatacttgccaatagactcattccttctaacaaaagtaatttttttttttcag
CAAGATCAGCATTGGACACAGCTGCACGTT
gtaagtatttcatctcaatattttatgtatgatttattctgccttaggcatatgagagct
tatattcaaagtgtcagtagttcagtatgaggaaaaactgctttagaaattgctttttaa
agttatgaggatgctatttgattggacagcccaaatatttttggcaattattcatgatgg
EXON 5  124 bp
tttaaaaaaattttttgaggttctttgaaaccctcaggggaaaaaattagcttgtatttt
aagatacgtgtatcttgatgtttttcttaatgctctttgtggtttgagatttgaagtaaa
gtgaggtaaagtctgttaacttgttttctaaaaaaagacatcatgttttctcccccaaag
CTACAAAGCCTCCCAGATATAAGTGTGGGATCTCAAAAGCTTGCCCTGAGAAGCATTTTG
CTTTTAAAATGGCAAGTGGAGCAGCCAACGTGGTGGGACCCAAAATCTGCCTGGAAGATA
ATGT
gtaagtctttgttgacttgagacgataaggtgtgctattaaattgcagccaattgaacct
gagtttaatggatattttgaaaatgtgttcggtatactttattaatggaaagtgatttcc
atttttgttatgtagtttttttctcatgaattcaagggaccttaaagttcttaaatttta
EXON 6  59 bp
aaattattcagtattagactgtcttctctgacttagtagagatctttttaatttcctccg
cagcactgaacaattgaaaatatgtataatattcctaactttttttgcaagactttattt
ttctgatatgttattgtacaatatttaattctaaatttatttcaatttctcccccttcag
TTTAATGAGTGGTGTTAAGAATAATGTTGGAAGAGGGATCAATGTTGCCTTGGCAAATG
gtaagaacaattattttagcttatggatgtaatcattgggtatttttctgtcccaaagta
aaatgcactatcagaggatcaggttagaaagtactgctcttgatgataaagccctctgtc
ccatccctgccctgcaaaaaatctatgggtggagacttggtgtctaagaatttatagcgt
EXON 7  51 bp
atgattcagattttaagttctcaaagtaattctttgagatgaattcacatctctctaatg
ctaatgaattcacatcttctctgctaatgaattcacatcaatcattggatgagattattg
gtcttacagtgtatgatatatttcagatgcataatttgatatgaatttaatctcttttag
GAAAAACAGGAGAAGTATTAGACACTAAATATTTTGACATGTGGGGAGGAG
gtaagcataaataacatgactgtgttcttttgctggcactaacttaatcacctcaataca
atgtagcccattaacgagagaatgatgatgctatttgcgttagttcattttgtttccctt
actttctgttcactaaatgtccagctgtatttaagttatcattcatgttttatatacttt
EXON 8  85 bp
gttaagggacaaatttaacagtttttaaactctttatgagatttgtctgtcttttggatt
actttacattggaaattattgctttacagatacttcatgttttataatactactttcaga
gattatcgtgatgcttattcagtcattttttaaaaccctaaaccctttctttttcttcag
ATGTGGCACCATTTATTGAGTTTCTGAAGGCCATACAAGATGGAACAATAGTTTTAATGG
GAACATACGATGATGGAGCAACCAA
gtatgtaaacttaaaactttacagaactttttggaactataatttgtaattataaaagca
atacattttcattaaaaaaaaaatctgtaacatagagcaaagtaatcaaactaccaggta
aacacaactaacaatttttgtttttactttgcctccttcctggttttatatgtaaatgtt
EXON 9  127 bp
tcttttgtcactaaagaattcaaccagtagaaatgtaactctgaaaaaaaattattttcc
aaaatgttctgttatttaaagtctcattttgtctcatgttttgtgttaatatcccagtga
accagtattagcatacagttccctctgtttattgttgtattctttctctccctcttcaag
ACTCAATGATGAGGCACGGCGGCTCATTGCTGATTTGGGGAGCACATCTATTACTAATCT
TGGTTTTAGAGACAACTGGGTCTTCTGTGGTGGGAAGGGCATTAAGACAAAAAGCCCTTT
TGAACAG
gttagtgtcatagactctcagaattaacaaaaacaaattctgtgaaaccttacggtacat
tttcccatcccagctatttgaaaattagataaagcggatagtaaatatgatcatatattt
gtcataaattcttggtaatcagttatttgaaataactatcgtacttttaaatttcaaaac
EXON 10  1698 bp
gaaggtctgccatgtatgtgatacagcctgagggtcactcatttaatatcttgaccagta
atttaaatgaacttattgttgacatgagtattactgaaatgagaagtgtgtaaaatgtta
cggcaaatcagcagtttacaacggttttttaaactgtatattattactgtgttccaatag
CACATAAAGAACAATAAGGATACAAACAAATATGAAGGATGGCCTGAAGTTGTAGAAATG
GAAGGATGCATCCCCCAGAAGCAAGACTAATGGAAATGTGGAGAGAATTGAAGAAAGCGC
ACTTTCACTCTTAATGGGAGAGCTATAAATGGCAGAGCTATGTGTAAATATTTTAAGAGC
ATGCAGCCATCTTGGTGTGTGCATGAGTATTGTCTCTTTTGATATCAGGATTATTTATTG
CTAACGTAAATAGATAGCATTGTAAATAATCATCACAATGATCAAATCACTGAACCATGT
CTCCGCACATTTCCCTAAAAGTACAATGTTTAGACTGCTATGGTAATACATATTTTAAAT
TCTAAAAGCATACACAATGTGTAACTGAATGGTTTGTGAAAAATATATTGATATATATAC
TAGTTGCTGTGAAAATATCATGGAATAATAGGGATTTTAGGGTGGATACTTTATTTTCTT
TTATATTTCTATATGTTGCGTTGTGATGACATTATCTTTTAAATTAAAAAGAGATTTGGC
TAGTTGTGTGTGTAATGTTACTTTACAGTCCGACTCTCCTGATGTACCTCTTTTCATGAT
CTTTTTCTTTCCTTCCCAAGAAACTGAGGAATGTTTAATATGAAAACATACATCGGATAT
GTGAAAAGCACAACAAAATTCTTAATGTACACAGTAAAAAAGTAAATATATAAATGTAGA
TGGCATTTAGGACCACAGCTTGCTGGATTTGTGTTAGCTATGGGAATAACTTGATTTTGT
ATAAGCTATTTAGAGTGAGGCTGGAGGTGGCAGCTTCACAGAACTGGAGAACCAGGCCAA
GTCCCCTCCCCAACCTAATTAGGTCATTCAGGACAGCTAAGTCAGTATATTTAGAGCAAT
ACTAGCATACGTTTTTCTTAATTGTTATCAGCATTGACCAAGTGGTTTGGAAGGAGGCAT
GCTTTAATATCACAATAATTTTGATTTGTAAACCAAGAAATTAATCCTGTGTTTATCTAA
CTTCATAATAGCAATTATTGCCCGAAGCTATAGTGGCATATTTACAAAAGTTCTTATTAC
TGGGCGGACTGATAACATTTAAAAAATAATTGTGTTTGACCCCAAATGACTTTATACCCA
ATTCTACATAAAAATATAGAAGATCTATCTTTTTTTGTTACCTTCAGATGTTCACTAAAT
AACTCAGTTTTTAAGCAGAAGTTTTCAGGGCATTAAATATATGTTGTGTATGAAGTATCT
CAAACTGGAACATAAATTTAGTGATCAAACTGCCATTCACAGTGTAAGGCAGCACTTAAA
TTTCGAACCTAAAGTTTAGATGCATTGTATAAAAAAACCTAAAAGCAGTATCTGTTATTT
AGCTGTAAACCAAGTTGGAAGCTATTCGGATAATTTCTTAAATATTGATGAACTTTGGAG
TACTGTTTCTTCCTTCAAACTGAATGTAATTAATTCATGAATAAATGCACCTTATATGTT
TAAACAATCTTTGTATACTTTTGGGATTTTTGGTGCTTATATGCTAAATCACATTCAGCA
TGTGTATTTTGACATTTAAAATACTTCCCTCAATTCTGTAAATTAAAAGAATAGTTATTT
TACAGTTCCAGGGATTGTGAAATAAATGTTGCAGTTTTTTAAAATAATGAAAATAAATAC
TCTTGGTTTTGCTTTGTG
aattttttttttttttgtattatctggcaaagtaatatacctacagaacttcacaaaaac
tcacacaaggtttttcaagcatttattatactgcctaacttggaaaaaaaattgttgctg
tggttaaaaatagtaatatcctagatgtatcttaacatgtaagaagctaagtatctagat