Gene EZH2 Variant 2
DNA : 76.94 KbNT_007914
mRNA : 2685 bp NM_004456
CDS : 4920 bp NP_004447
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  159 bp
cagcgaaccccgccgccgcccgcgcgcgcacgcgctgccagtgcccgcccgcccacgagc
cctgagcgcactctgcgtggggctggctcggcgcctccgagcccggcgggccctgtgatt
ggacgggcgcccgcctcgcgtcccgccaatcggggcggcgcttgattgggctgggggggc
CAAATAAAAGCGATGGCGATTGGGCTGCCGCGTTTGGCGCTCGGTCCGGTCGCGTCCGAC
ACCCGGTGGGACTCAGAAGGCAGTGGAGCCCCGGCGGCGGCGGCGGCGGCGCGCGGGGGC
GACGCGCGGGAACAACGCGAGTCGGCGCGCGGGACGAAG
gtaacgcgccgctgcgggcggcccggccggcggggctccgggagtgcgaaccgggcggcg
gcggcggcgccaggacctccccgccactgctgtgccggtcccgggtatcgccgagcgggg
ctcaccggggcgccgcgtttgtaggcgtgcggggggtggagggtgaggggagagcccccc
EXON 2  124 bp
tttcaatgaagtgttttaaggatttaaccatgcagcacaaatgagcacctttctgtaaat
gccaacagtgtaatatgtgtcatttcttcactgattgttagtttgctgcggattaaaaca
caggtgatcatattcaggctggttagattagtgattttaatatgaaaccattgcttttag
AATAATCATGGGCCAGACTGGGAAGAAATCTGAGAAGGGACCAGTTTGTTGGCGGAAGCG
TGTAAAATCAGAGTACATGCGACTGAGACAGCTCAAGAGGTTCAGACGAGCTGATGAAGT
AAAG
gtataattttatcttttgtgaaaatgaatatacaattaaggataggttttttcccctcct
aagttcaataagtttttatttaaaataattctagccaagtttgtatttacaataagatga
gtgaatacttggaagcttaggttcttgatctgtcttaacattataccatgcacattaatc
EXON 3  129 bp
gatgtggtgtttttgtattatttgaatgtgggaaactatagtgtaaaatctatatgcacc
taagaaaatgttcttgatatttttgaggatacactagatttttaacctgctttacaggtg
ttatacattttctaacaatgaacaatttctcctttcctctccttcatttttttttttaag
AGTATGTTTAGTTCCAATCGTCAGAAAATTTTGGAAAGAACGGAAATCTTAAACCAAGAA
TGGAAACAGCGAAGGATACAGCCTGTGCACATCCTGACTTCTGTGAGCTCATTGCGCGGG
ACTAGGGAG
gttggttaacataacatgttgtagtaattatcatcatcttttggtttatgctattggaac
atttgtttggttattgggaggaaatcattgacctcagggtgtccatctttttattgctat
ttctttttaatgtgcaactgttaatgactgctgtagatcacactattagctattcctata
EXON 4  117 bp
ccctaagtaaaagaaaagagagaatcctatttggtttatatgaccactttactgtcctag
gtaaggacttttttttcaaaattaaatatttgggtaggcagcatctctttacaatatgat
ggctacagcttaaggttgtccttttattcttaagagtcaattttattttttctgttttag
TGTTCGGTGACCAGTGACTTGGATTTTCCAACACAAGTCATCCCATTAAAGACTCTGAAT
GCAGTTGCTTCAGTACCCATAATGTATTCTTGGTCTCCCCTACAGCAGAATTTTATG
gtatgtaaataagatatcttctgcttatttgataataacttatttgaagtaaaaaagcat
agataattttattgtcaaggtgaatcaagacagtataaattctaaaaagctatcaaaata
acacttgaagtaatttttaaaaattgattaaggtagtttttttaaggcctgtgcagtatt
EXON 5  121 bp
cttattggtgagaggggtcttttattttttgataaattttagagtttgctctctgactag
tattttaaatctggagaactgggtaaagacatgtacacatgaaaaaaaggttgtatttta
gttatttcacatttgatacttagagtaaacctgctttttaaatatatttttttcttttag
GTGGAAGATGAAACTGTTTTACATAACATTCCTTATATGGGAGATGAAGTTTTAGATCAG
GATGGTACTTTCATTGAAGAACTAATAAAAAATTATGATGGGAAAGTACACGGGGATAGA
G
gtgagccatatgcttcttctcttggaaaaaggggctaaagaattgagagacacttttgtt
tatgaagcatatagggcatgagaaaaattttaatattaaaattaagttttgcactgaact
ataagggactgaacctgggcccaggcctaagattttcagtattttccctaactatttttg
EXON 6  141 bp
tgcttcctttgcctaacaccagtcctgaaaatgatcttatcttttcctcccctcatttca
ataataatgttttagtgccagttactaggctatgcctgttttgtccaagtagaaaaagga
tacataaacttttgacattattgcttctcctgtgtgtttctgacatttgatgcgtttcag
AATGTGGGTTTATAAATGATGAAATTTTTGTGGAGTTGGTGAATGCCCTTGGTCAATATA
ATGATGATGACGATGATGATGATGGAGACGATCCTGAAGAAAGAGAAGAAAAGCAGAAAG
ATCTGGAGGATCACCGAGATG
gtatgcctgattattaggattctgtgtagccattacagctttctttcaaaaacagtagaa
agagtagaaatagggcttagtttcttctttctctttttctttctttgttaaatatcacat
tgatagcagtataatcaaaattaacatattatggccaggtagggtggctaactctgtaat
EXON 7  103 bp
tttttgactgactggcattccacagacatgtaaagtatgtgagaagtaagtaaaacacaa
aatagagatgatttcttagaaaatcagctttgttatagagacataattgggtagagaaaa
tgaaagatcaaaaacttgtttacttccattctttttttcctttcatattctcctgtttag
ATAAAGAAAGCCGCCCACCTCGGAAATTTCCTTCTGATAAAATTTTTGAAGCCATTTCCT
CAATGTTTCCAGATAAGGGCACAGCAGAAGAACTAAAGGAAAA
gtaagaatttgttcctttgaggcaatcttgccctgtatggtatgtaactcaccattttgg
tttattacaaatggaatcaatgtagcggatgagccactacactttgtttacagtgtttgc
aagatacttgaagcaacatgtgtacttgtggtactctgcattacaaaatatttcctgtag
EXON 8  179 bp
atttgattcttgataacaccatgcacaatatttagttggctctttatctaaatagagcca
ttcctttatgttttaggcaagataaacatcaaaagtaacacatggaaaccttttagaaac
tgttttcaaaaaagtgatttttgtttcatgtttacttaaatttttcttggttaatgtcag
ATATAAAGAACTCACCGAACAGCAGCTCCCAGGCGCACTTCCTCCTGAATGTACCCCCAA
CATAGATGGACCAAATGCTAAATCTGTTCAGAGAGAGCAAAGCTTACACTCCTTTCATAC
GCTTTTCTGTAGGCGATGTTTTAAATATGACTGCTTCCTACATCGTAAGTGCAATTATT
gtacgttttcattttctatctttgttgtggaattatgttttaaagcagcttggagagtgc
tatcatttattacaactagaatttatcatttaatcttgtagttactttgacaaatatctt
tagatctcagtattattatttttactttgttgcttgaggattgctctgaaatcttttgca
EXON 9  92 bp
aggaatggagaatacgttgtgatcattcagtaagagcctgaaggaaagttgtatgaagta
acgtaaaccacatattagcaagattataatccattaattgacttttccagtggaactgga
agagtgaaaaagtaagtattttatagttatattagattctttgtttcatttattttgcag
CTTTTCATGCAACACCCAACACTTATAAGCGGAAGAACACAGAAACAGCTCTAGACAACA
AACCTTGTGGACCACAGTGTTACCAGCATTTG
gtaagacttagtgcctaattattgcagagggtacttgagaggactttgcactttggtgga
ggtgatcaagtcagcgttaatgttgtctgcacccatgctgttatgggccatatgatagac
agagctttctcacccatgctgtttcttccatagctcatgtactgcacattttagtccttc
EXON 10  241 bp
attttcagactatcaaaagcatatcaaaacaagtatattagacatgcaaatgattatttg
tgataaatggataatgtgatacattttttgactaacctggcttatatagtattttttttt
ctcttccatcaaaatgagttttagaactttgccctgatgttgacatttttcatttcgtag
GAGGGAGCAAAGGAGTTTGCTGCTGCTCTCACCGCTGAGCGGATAAAGACCCCACCAAAA
CGTCCAGGAGGCCGCAGAAGAGGACGGCTTCCCAATAACAGTAGCAGGCCCAGCACCCCC
ACCATTAATGTGCTGGAATCAAAGGATACAGACAGTGATAGGGAAGCAGGGACTGAAACG
GGGGGAGAGAACAATGATAAAGAAGAAGAAGAGAAGAAAGATGAAACTTCGAGCTCCTCT
G
gtaagacacgtctaataactgggttttactgttctgtgaaagttcgtgttgtgaggatta
aggatgtataatgcattgaataattttcttagttggttagtttcagtataaagaccagag
ttatctcaagaatgtgtagctgtgttgtttctgtttcctgcctgcacccgtaccctagct
EXON 11  170 bp
tattcttgacgttctgtgagtagttttgttggaaaatgtgaactacgatgggttagtgtt
ttgccgattggatttgagttgtcctcatcttttcgcttttttcttaagcacaccctgaat
tgtacttcttaatattatttccaatcatttcttgaccagtgcttacatttggttttgtag
AAGCAAATTCTCGGTGTCAAACACCAATAAAGATGAAGCCAAATATTGAACCTCCTGAGA
ATGTGGAGTGGAGTGGTGCTGAAGCCTCAATGTTTAGAGTCCTCATTGGCACTTACTATG
ACAATTTCTGTGCCATTGCTAGGTTAATTGGGACCAAAACATGTAGACAG
gtaagatatccgataaaaatgttgttaaaagagcttcaaacatagagataaaactgtact
cgttgtccaaacaaagaaaattcttggttattactaagctcctattcatctcctaaaaat
aatttttttttcttcccaagagggaattgaatgaaaattattctccaggtatgttacaga
EXON 12  95 bp
gaccagaatataattacagctacccctaatgtgagggtagggacagcgatgtgtgttata
tccccagcatctagcagtgtcacagaagagacaaagacatttttctggtatgcatgagta
taagaatggtttgcctaaataagactgtcctcatggctctgtgactgtgcctcttgtcag
GTGTATGAGTTTAGAGTCAAAGAATCTAGCATCATAGCTCCAGCTCCCGCTGAGGATGTG
GATACTCCTCCAAGGAAAAAGAAGAGGAAACACCG
gtgagtctgtcatgaagctccttagagaagtcaacatagatagacactgcaggcaaggcc
cttcctaagggctgttgttggtttctacttagtctatttttaaaaaaccttaaactgcca
tcaaaaacagaactatggaatcttatttccactgggaattgctagtatttttctataaga
EXON 13  41 bp
tgagccatcaagctgtttgagttgcttcaaactgatggcaaatataaactgggcagggca
tgactcttggctttaacgcattcctgtattcatggcacagatagatccagttaagcagct
ctctgttggatttgtagcttcccgcagaaatttggtttaattttctttgtgtttttgcag
GTTGTGGGCTGCACACTGCAGAAAGATACAGCTGAAAAAGG
gttagcatctttccattcctctcattattagcttaacaatatctgctttgttttcatttg
ttttagaatagtaactggattagagcttgggttattctaatataattgccttctgtatgt
taaaccaatttgaatggaggacgtctactgatgaatccccagtcaattctcttctgtaaa
EXON 14  126 bp
ggtgggagagtattttttgccatcgttgtggaaaccggaatatgtgtaatgttatgcatt
cagtaaaggcaggccagctacactccacaggtagtagggaagaatgtactcgtgttaatt
gtgtatgatcgtttccatctccctggattcattggcctgcatgatgttatctttactcag
ACGGCTCCTCTAACCATGTTTACAACTATCAACCCTGTGATCATCCACGGCAGCCTTGTG
ACAGTTCGTGCCCTTGTGTGATAGCACAAAATTTTTGTGAAAAGTTTTGTCAATGTAGTT
CAGAGT
gtaagtatttgttgctttgatgcaattgcatgagaactaaataggtctttggttagcaat
ttaaaaaatcaaaaataagaacatgggagcactcccttgtttacttgacgaaactcatca
atttgacaagtatttattgagccccatacctggccctgtgccagtggccagtcagtcgcc
EXON 15  179 bp
agtgcaaacagctataacttcgctgttaatacttccatttccttgtctatatagtagggt
aataaggtggttgtgagggttgagagtcagtgagatgcccagtacagcccttgccacgta
tctttctgcaagtttttgcatacggtgatgagtgaagaacctccaaacctctctctgaag
GTCAAAACCGCTTTCCGGGATGCCGCTGCAAAGCACAGTGCAACACCAAGCAGTGCCCGT
GCTACCTGGCTGTCCGAGAGTGTGACCCTGACCTCTGTCTTACTTGTGGAGCCGCTGACC
ATTGGGACAGTAAAAATGTGTCCTGCAAGAACTGCAGTATTCAGCGGGGCTCCAAAAAG
gtgagcaacaagtcacttctggaagattgtttgtagttagctatttagtgatgcaaatgt
caggattgccttagatgatttagctggggcaaaaagtaaaagtgatccttgaaaggtgca
actgatgagaaagtgttcataattttctctgggtaatgcacccttgggcagtctcttcag
EXON 16  96 bp
gttcatagccattctcagcagctttcacgttgactgaagctgtgtgcccaattactgcct
tagaacaaacaggtctgaggatttacagtgatagcttttgttttcattctgtagtctact
ttgtccccagtccattttcaccctccttttttgatgatgtgattgtgttttattctctag
CATCTATTGCTGGCACCATCTGACGTGGCAGGCTGGGGGATTTTTATCAAAGATCCTGTG
CAGAAAAATGAATTCATCTCAGAATACTGTGGAGAG
gtaaggcactgataacctgtattcaggtggcattgtatatactaactttactttatttta
gattgattttattaggtaagtctgtgggtttgattggaaatgaattgccataaactgcct
tttcagcctggacttctgcatgtttgtggatttgcatgcttagtaactggattgtgctgg
EXON 17  82 bp
tagtatacagttattctttattactgcgcagaccgaatgggaaagagaacttggctgtag
tgaccctttttgttgcgttttctccagaaggtccagtattcactctgtgcgcttttgtgt
gttctgtcaggcttgatcacctttatccaaaagaattttctcctgtgtctttctttttag
ATTATTTCTCAAGATGAAGCTGACAGAAGAGGGAAAGTGTATGATAAATACATGTGCAGC
TTTCTGTTCAACTTGAACAATG
gtatgtttcagagctgggaggcagtgagttcctgagttgcatgtggcagccttctgccgg
ccgagtgttcagaaacgagggtagaggtcagtgaggtgaccagaaggaggatctccttag
aggcatggggggctgcttgcttgaaaggaactggagcaaggaattcctcagggagcagat
EXON 18  81 bp
cctggaacaatagtgtgttcttccaaatgtcatttcttactgaatgaagctgcttgattt
atttgcttttgcaggcaaaccctgaagaactgtaaccagttgcatttacaaaatcataat
aacttggtttacttataactgaaattattcactgggctgtgcttacttttttctttttag
ATTTTGTGGTGGATGCAACCCGCAAGGGTAACAAAATTCGTTTTGCAAATCATTCGGTAA
ATCCAAACTGCTATGCAAAAG
gtaggtacctttgacgtgagaattggaactcccttttcagtcctgtgatgatggacttga
atacttctgggatagttgtttgttatgtgaacaagtcagttaaccccccgtggcccgtct
tcatgctcactgacaccagtgtgtctctttgcagttatgatggttaacggtgatcacagg
EXON 19  85 bp
ggtaaatccaaactgctatgcaaaaggtaggtacctttgacgtgagaattggaactccct
tttcagtcctgtgatgatggacttgaatacttctgggatagttgtttgttatgtgaacaa
gtcagttaaccccccgtggcccgtcttcatgctcactgacaccagtgtgtctctttgcag
TTATGATGGTTAACGGTGATCACAGGATAGGTATTTTTGCCAAGAGAGCCATCCAGACTG
GCGAAGAGCTGTTTTTTGATTACAG
gttggtaaagtacatttctagcatgatctctaagggctttttctactggattgtgaactc
tggacaaaggagggtttttagttctttgcttcttttgatgggtcactttgccatgagcat
tagtggggaattaggttacactttcctgttatgtatttattatccatttatatattatac
EXON 20  324 bp
ttgccttctatgaatgtgccgttatgcaggcagctgtgtaattggatgggtttttttttt
ttttttttttttaaagacattttaatgcacccactatcttcagcaggctttgttgtgtta
agtctcagcacatgttggatgggtggccatccagcggacatctccttcctgttgtttcag
ATACAGCCAGGCTGATGCCCTGAAGTATGTCGGCATCGAAAGAGAAATGGAAATCCCTTG
ACATCTGCTACCTCCTCCCCCCTCCTCTGAAACAGCTGCCTTAGCTTCAGGAACCTCGAG
TACTGTGGGCAATTTAGAAAAAGAACATGCAGTTTGAAATTCTGAATTTGCAAAGTACTG
TAAGAATAATTTATAGTAATGAGTTTAAAAATCAACTTTTTATTGCCTTCTCACCAGCTG
CAAAGTGTTTTGTACCAGTGAATTTTTGCAATAATGCAGTATGGTACATTTTTCAACTTT
GAATAAAGAATACTTGAACTTGTC
cttgttgaatcatctctcataacgtgtcaataactgctttcaggactgctcaacaaaaaa
cttttaaatttaactccttgggttttttagttgtctttgtatgaatcttgatttaactaa
tactgcctgtgaatatgtggaagacatatatgaagaacactgctgtgcatcctgagggct