Gene DNAJB6 Variant 2
DNA : 49.30 KbNT_079597
mRNA : 1559 bp NM_005494
CDS : 726 bp NP_005485
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  130 bp
cagtctcctgggctcttcggggcggcggaagagccgagaaccttcgcgaaggtggggcgg
gcgcccccgaggttgggcccgcggtatgggcagtggaaactgcgcatgcgcggcgtcagg
gtcgggcggaagttgacgccgccgtgccgccgccgcgtgacgcatttcctgtttgttgtt
GGAGAAAGGAGAGAAAGGAAAGCGCGAGGAGCCGCCGCCACCACCAGCGCAAGCAGTCCT
GGAGCTGTGAGGAGATTCGGGCCGTCACCCTGCCTCCCCTGCGTCCCGCCACCGGCCGCT
TCTGTCCTCG
gtgagggtctgttccgagggtcgggggaggtcgcctagggcccgcgcgcgcccggcagac
ggcggacctcacccggcgcctggcaacagcgcggggggtgaccggggtcgccggccgggg
aaaggactggacggggcgggggcgtggccggggttgcggggcgaagggtgggcggggtcc
EXON 2  91 bp
ccagttcccagacaaggtcttggcccagcaggctagtggttagctctagtggaagttccc
tctgtaggccagtaggtgctaaggtgacaccaccccttcctccctctccagacccatccc
accaccgtgatttgcccatccccagcagcctcatcactgaccacctgtttttacttgcag
GACCCATTCCAACAATCTCGTAAAACATGGTGGATTACTATGAAGTTCTAGGCGTGCAGA
GACATGCCTCACCCGAGGATATTAAAAAGGC
gtaagtagttttatttctgtggtaatgcattttcacagtggtacattggtaattgagtag
tataacttcttctattgcctatgaaaatggcttttaatgtagtataccagtctttgaatg
ccacatagtttaatttgacagagcagttaacgagcatttgcagtctaggcctgggctttg
EXON 3  110 bp
ctggattttagaactttgtgtatttcattgtagaggaaagggaggttttacagttaaaac
cagtattcatctcaccagttggcagctctgaagccattctcgtggttaatgatgttagtt
tcaaaagcatagttgatttctggatttagaatgtgatctatatcctttattctttccaag
ATATCGGAAACTGGCACTGAAGTGGCATCCAGATAAAAATCCTGAGAATAAAGAAGAAGC
AGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTGTCGGATG
gtgagtgacagcgagctgctgaaggaccctgagcgggcatgccggaatgcggagtgggtg
ttgggatcctcctcagggtagcacagtatggactcaagtgacttgtttttgatgcctact
ggattttgggcccttctaagagatttttacttttctcgtgaagatttgaattgatttagg
EXON 4  60 bp
gagagaggtacagaaagttttccctgttgctttgttttgttttaaagaaaaggtggccat
actccttgaaattcagttgtaaaacatcgaaaactgatttacaactggggaaatacctta
tctattgaattaagggtttaaaaggaacttggccttaccgacttttctttcaatttttag
CTAAGAAACGGGACATCTATGACAAATATGGCAAAGAAGGATTAAATGGTGGAGGAGGAG

gtaagtacgtgagttttttctttgaagacaaaaggtcttggcaagtaagttgagtttgta
aatcacgagtctcttggtcagagtcgattttgtatcagtaaatagagatgcaacgtagaa
agcgaactaaattggggagaggacagagaaattgatggcatttaaaagtcttttacgaga
EXON 5  111 bp
ctgggcacactcactctctgtcagtacagggctcatgttttgaattatagagaacttcag
gtttatgaaatatttttgtttttattagttcatgatttgtataatgttttgtcaacaaag
aattctttgcctacaaagcaccaaaattcataaactaaaagctgtgttgtatttgtgcag
GTGGAAGTCATTTTGACAGTCCATTTGAATTTGGCTTCACATTCCGTAACCCAGATGATG
TCTTCAGGGAATTTTTTGGTGGAAGGGACCCATTTTCATTTGACTTCTTTG
gtaagttaatcacgtgggttgacttggtgtgtgtccatgacccaaatgagggcttactta
gtatggcctttctgttgaattaacattgtattttaggctgggcgcggtggctcatgcctg
taatcccagcactttgggagcctgaggcgggcagatcacctgaggttgggagttcaagac
EXON 6  132 bp
gtaaaactgttggtgaggtagtgtttcagttactctgtagataagctcttttgttaaaac
ctcttaagttttttgttcctgaatatgttacaaacatctattttctcttactgtagctat
cacatgaggaaaaaaacttgaaaaaaagacttcatagtgtgtgtttatgtttgattttag
AAGACCCTTTTGAGGACTTCTTTGGGAATCGAAGGGGTCCCCGAGGAAGCAGAAGCCGAG
GGACGGGGTCGTTTTTCTCTGCGTTCAGTGGATTTCCGTCTTTTGGAAGTGGATTTTCTT
CTTTTGATACAG
gtattaaatccctaggtttaatctctgttatcttaacagcagttagtacttataaaatca
taatactcttttagttagagtgctttaaaatatgtgtatacctttcgtagaatagcattg
tggatttgccagctttttttggtatacaggtctgcgcttaacctacattttctcctaatc
EXON 7  142 bp
acagtctttccccctgggcaccccagcacttcagctgaggccttgatagttgcgtcgttt
attactcctcggttctatgccttaacattaaatattctgctactgaactttcaaactctt
gtctttgcattactagttgacatatttctttaagcatttttcttttctgttttcctgtag
GATTTACTTCATTTGGGTCACTAGGTCACGGGGGCCTCACTTCATTCTCTTCCACGTCAT
TTGGTGGTAGTGGCATGGGCAACTTCAAATCGATATCAACTTCAACTAAAATGGTTAATG
GCAGAAAAATCACTACAAAGAG
gtactgtggtattctgcattttatatttttagtaagcaggcgtaacgtttcactggtgcc
atgttgcacgtctcccagagtgtgaagtagaggttgttgtatgctaaatctggcgccatg
aaaatcttttgctctccaaattcattaattaaagccttttctcttaaattttacttaact
EXON 8  783 bp
ttaattctattttaggaaaggaagatgtgttgttgacaggttggcttcagccatgttttt
acagcctgaaaattacttatattcatggtgtatttcagtaatgtccttaaacaacttagt
taccctcacacatgcattttctttaccagaaaggtttttaaatgaatttttttcctacag
AATTGTCGAGAACGGTCAAGAAAGAGTAGAAGTTGAAGAAGATGGCCAGTTAAAGTCCTT
AACAATAAATGGTAAGGAGCAGCTGCTGCGCTTGGATAACAAGTAATTCAACGCACGCAC
TTAACAGAAATGTTAAACTATAACAAGCACCATTTGAGGATTAACAGGAACATTTTTTTG
AAGATTTCAAACGAACTCGACTTTCAGTATAATTGTACCTAAAGTATTTATAAACAGCTC
ATCGGAGCCTCTATTTGTCATAGACTTTTGAGTTGATTGTTGGGACCACATAATAGGACC
ATTTTTTTTTTGTCTTTAAAATTGTTGTAAATCTCTGTATGCACTTTGCTTTTTTATTAA
ACGTACTCCAAGGTGAGTCTTGACTCTTTAGTGTAGGACAAGATTGTACACTAACACCAG
CATGGACCTGCTTTTCATTGTGTCTGAAATGTGAGCCACGTAGTGTCGGCCTGCTGTGAA
GTTAACATTGCCAGGACGATTCTTCTACAGAAATAATTTCAATTTTTTTCAGTATTTAGT
AGTGAAAGATATTAATACATTAATGGTAATACATTTCTGGTTTAATATAAATTAAGGATG
TTTTCTAGTTGTGCATGAATGCTGGCAACTTAGTAAGTTTTGACAATTGTTTAAATATGT
AATGTTAAGCTTAGGTTTAAAAAAGTAAAGCTGGTAAACTGGGTCTTTGTCATTTGCTTT
AAAAAAAAAAAAAAAGAAAATAAATGCGAATGTGTTGGTGCATTCTTCCTGAGTGGGATC
TGG
agcttttttgtgtctgtgtatgatttgtgcctgggcttctagtgtcactttaatagcgtt
tcgtgctgttcattcaggtggatgccgcacctcagttacatgtagacattttcttcagta
tatttgaagtatatgaagattttcatattgtaagttgtgatttagcaattgatcaaacat