Gene DNAJB6 Variant 1
DNA : 80.30 KbNT_079597
mRNA : 2477 bp NM_058246
CDS : 981 bp NP_490647
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  130 bp
cagtctcctgggctcttcggggcggcggaagagccgagaaccttcgcgaaggtggggcgg
gcgcccccgaggttgggcccgcggtatgggcagtggaaactgcgcatgcgcggcgtcagg
gtcgggcggaagttgacgccgccgtgccgccgccgcgtgacgcatttcctgtttgttgtt
GGAGAAAGGAGAGAAAGGAAAGCGCGAGGAGCCGCCGCCACCACCAGCGCAAGCAGTCCT
GGAGCTGTGAGGAGATTCGGGCCGTCACCCTGCCTCCCCTGCGTCCCGCCACCGGCCGCT
TCTGTCCTCG
gtgagggtctgttccgagggtcgggggaggtcgcctagggcccgcgcgcgcccggcagac
ggcggacctcacccggcgcctggcaacagcgcggggggtgaccggggtcgccggccgggg
aaaggactggacggggcgggggcgtggccggggttgcggggcgaagggtgggcggggtcc
EXON 2  91 bp
ccagttcccagacaaggtcttggcccagcaggctagtggttagctctagtggaagttccc
tctgtaggccagtaggtgctaaggtgacaccaccccttcctccctctccagacccatccc
accaccgtgatttgcccatccccagcagcctcatcactgaccacctgtttttacttgcag
GACCCATTCCAACAATCTCGTAAAACATGGTGGATTACTATGAAGTTCTAGGCGTGCAGA
GACATGCCTCACCCGAGGATATTAAAAAGGC
gtaagtagttttatttctgtggtaatgcattttcacagtggtacattggtaattgagtag
tataacttcttctattgcctatgaaaatggcttttaatgtagtataccagtctttgaatg
ccacatagtttaatttgacagagcagttaacgagcatttgcagtctaggcctgggctttg
EXON 3  110 bp
ctggattttagaactttgtgtatttcattgtagaggaaagggaggttttacagttaaaac
cagtattcatctcaccagttggcagctctgaagccattctcgtggttaatgatgttagtt
tcaaaagcatagttgatttctggatttagaatgtgatctatatcctttattctttccaag
ATATCGGAAACTGGCACTGAAGTGGCATCCAGATAAAAATCCTGAGAATAAAGAAGAAGC
AGAGAGAAAATTCAAGCAAGTAGCGGAGGCATATGAAGTGCTGTCGGATG
gtgagtgacagcgagctgctgaaggaccctgagcgggcatgccggaatgcggagtgggtg
ttgggatcctcctcagggtagcacagtatggactcaagtgacttgtttttgatgcctact
ggattttgggcccttctaagagatttttacttttctcgtgaagatttgaattgatttagg
EXON 4  60 bp
gagagaggtacagaaagttttccctgttgctttgttttgttttaaagaaaaggtggccat
actccttgaaattcagttgtaaaacatcgaaaactgatttacaactggggaaatacctta
tctattgaattaagggtttaaaaggaacttggccttaccgacttttctttcaatttttag
CTAAGAAACGGGACATCTATGACAAATATGGCAAAGAAGGATTAAATGGTGGAGGAGGAG

gtaagtacgtgagttttttctttgaagacaaaaggtcttggcaagtaagttgagtttgta
aatcacgagtctcttggtcagagtcgattttgtatcagtaaatagagatgcaacgtagaa
agcgaactaaattggggagaggacagagaaattgatggcatttaaaagtcttttacgaga
EXON 5  111 bp
ctgggcacactcactctctgtcagtacagggctcatgttttgaattatagagaacttcag
gtttatgaaatatttttgtttttattagttcatgatttgtataatgttttgtcaacaaag
aattctttgcctacaaagcaccaaaattcataaactaaaagctgtgttgtatttgtgcag
GTGGAAGTCATTTTGACAGTCCATTTGAATTTGGCTTCACATTCCGTAACCCAGATGATG
TCTTCAGGGAATTTTTTGGTGGAAGGGACCCATTTTCATTTGACTTCTTTG
gtaagttaatcacgtgggttgacttggtgtgtgtccatgacccaaatgagggcttactta
gtatggcctttctgttgaattaacattgtattttaggctgggcgcggtggctcatgcctg
taatcccagcactttgggagcctgaggcgggcagatcacctgaggttgggagttcaagac
EXON 6  132 bp
gtaaaactgttggtgaggtagtgtttcagttactctgtagataagctcttttgttaaaac
ctcttaagttttttgttcctgaatatgttacaaacatctattttctcttactgtagctat
cacatgaggaaaaaaacttgaaaaaaagacttcatagtgtgtgtttatgtttgattttag
AAGACCCTTTTGAGGACTTCTTTGGGAATCGAAGGGGTCCCCGAGGAAGCAGAAGCCGAG
GGACGGGGTCGTTTTTCTCTGCGTTCAGTGGATTTCCGTCTTTTGGAAGTGGATTTTCTT
CTTTTGATACAG
gtattaaatccctaggtttaatctctgttatcttaacagcagttagtacttataaaatca
taatactcttttagttagagtgctttaaaatatgtgtatacctttcgtagaatagcattg
tggatttgccagctttttttggtatacaggtctgcgcttaacctacattttctcctaatc
EXON 7  142 bp
acagtctttccccctgggcaccccagcacttcagctgaggccttgatagttgcgtcgttt
attactcctcggttctatgccttaacattaaatattctgctactgaactttcaaactctt
gtctttgcattactagttgacatatttctttaagcatttttcttttctgttttcctgtag
GATTTACTTCATTTGGGTCACTAGGTCACGGGGGCCTCACTTCATTCTCTTCCACGTCAT
TTGGTGGTAGTGGCATGGGCAACTTCAAATCGATATCAACTTCAACTAAAATGGTTAATG
GCAGAAAAATCACTACAAAGAG
gtactgtggtattctgcattttatatttttagtaagcaggcgtaacgtttcactggtgcc
atgttgcacgtctcccagagtgtgaagtagaggttgttgtatgctaaatctggcgccatg
aaaatcttttgctctccaaattcattaattaaagccttttctcttaaattttacttaact
EXON 8  71 bp
ttaattctattttaggaaaggaagatgtgttgttgacaggttggcttcagccatgttttt
acagcctgaaaattacttatattcatggtgtatttcagtaatgtccttaaacaacttagt
taccctcacacatgcattttctttaccagaaaggtttttaaatgaatttttttcctacag
AATTGTCGAGAACGGTCAAGAAAGAGTAGAAGTTGAAGAAGATGGCCAGTTAAAGTCCTT
AACAATAAATG
gtaaggagcagctgctgcgcttggataacaagtaattcaacgcacgcacttaacagaaat
gttaaactataacaagcaccatttgaggattaacaggaacatttttttgaagatttcaaa
cgaactcgactttcagtataattgtacctaaagtatttataaacagctcatcggagcctc
EXON 9  207 bp
gaggattaagttctggccccagtggcgccactgaagaaaggagataacctctttctcctg
cccggagatggcgcgtctggattcagggagatcgtgcggccagcttccctccctctgctc
tggatgggggccggccgccgccgctcactcacggctctctctctcccgctgtgcctgcag
GTGTGGCCGACGACGATGCCCTCGCTGAGGAGCGCATGCGGAGAGGCCAGAACGCCCTGC
CAGCCCAGCCTGCCGGCCTCCGCCCGCCGAAGCCGCCCCGGCCTGCCTCGCTGCTGAGAC
ACGCGCCTCACTGTCTCTCTGAGGAGGAGGGCGAGCAGGACCGACCTCGGGCACCCGGGC
CCTGGGACCCCCTCGCGTCCGCAGCAG
gtgtgcaaagggaggcagccgtggagcaggcgcagagtgagacttctctgggtgccagag
gacagcgaggacacaaaccgcgcctgggctgctgtgttctgacctgagcgggcgtgggcg
gtcgggcggggcgggaggaggtagcctcgctctgctcctctcccgctcgcggcgccccac
EXON 10  1423 bp
gcagttctcaacgtgcaccttggaaagcgcccgttttgaggtttagctgtggccaagata
gatgacttcattttgttgctttttgttcttaacatggggagatatttagaaaacatgttt
ggctcttgctggggaagcagtgctgttccgtacagtgttttacaagccgtgtttccttag
GATTGAAAGAAGGTGGCAAGAGGAAGAAGCAGAAGCAGAGAGAGGAGTCGAAGAAGAAGA
AGTCGACCAAAGGCAATCACTAGACCGGACTTGAGGCACGCGGTGCACCCCCAGACGCTG
GCGCTCCACCGTGCTCGGCATGCGGTCGTGCACACGCGCTAGGTAGCAGCGTCGGTCAGG
ACTGTCTCGAGGCCACACTCGCTCGGCAGGATTATGCGATCACGGATCAGTCAGAGCAGG
GTCAGGAGACGGGGCTGACGGCACGGGTGGCGGGGACAGACGTTTGGGACTTGGCCGCGA
CTCTCTGCTTCTCTCCAGCTCTCAATCTGCTGCATTTTCCTCTAGTGCTTCCGGATCCTC
TTCATTCTTTTCGGCTACTCAACCACTCCGCATGCTGCTGGAATATTTCTGGCTTTAGAA
GTACAGGAGGGCGCAGATGGCTAACTGAGTAACATTCATGAAATGAGGCTTTCTGTGGCG
GCGTAGTGTTTGGAATTAGAAGGTAATTCAGTAGAGTGTAACTTAGAGAATATTGCAAGT
GACACATTGAATCCTGCCCGTCAGGGCACCTTTTCCTCAGAGCAATCCGGCCACACGAAT
AGAAGGCTGTCGTGAATCACATCAGATGTAAAATCATTCCTTCTGTTTACTCTTTTAATT
TTCATCCTTTGCAGGTAGTGCAAATTCAACTTCAAATATGGTGTAGGTTTTGCTAGATTC
CATATTTTTTTCTTGGATTTTTGCTAATTATTTTTAGCAAAAAATTTTTGCTCAGTGGCA
CCCTCCCTAGTGTCCATGGGTTAGGGCCATGCTGGGGAAAACGGGCCGGTATTTACACAC
GCGCAAAACACCCAGAGACGGCACAAGGAGGTTGAACTCATGTTTCAGTTCGCGAACATT
GACTCCTTACGAAAGTCACTTCATTCTAACTAGATGCGCCCACTTCCGGTCATTATTTCG
TTTGCATGATGTATTGCTTCTTCACGTTTTGTTTTTATTGAGCACGGAGTAGAATTCCAG
GGCTGCCTTGACTTCTTCCCTGCATGCTCCCTCCCAGTGACTTTCCTTCCCTTTCACATG
AGGATCTGCCGTTCATGTTGCTTTCTCCTTTGTCCTCTTGGACTTGAGGGCATTGTGAAA
AGCTTTGCTGTGATTTAAAAATGCCAGCAATTTTAATCTAGCAGTGTTGAAGCTGGGAAT
TTTTTGGCGCAATCCATGTAGCAGTGACCCAGGCTTGGGAGCCAGAAACAAGTGTGACCT
GGGATTTTATTTAACACAACTGTTGCCAAAGAGTTGGCTTTGTTTATTTGGTTTTGGCGG
GGAGAGGAGTGGTATTTGATGCTTTCTGTGGACAATGTAACCCTAAACACATCATGTATT
TTAAATGCCACCTACATAAATAAAACATAAGCATATTGAATAC
agctcgcctgctgtcctttgtaagcgccagtaagttgcaccgttaagactgactagaaat
aaaagcaattcttcaacattacgattacaaaggatgaaagtggtgttttgcaggcagaag
ccttgcttccgaaatgcgtcactgtaaggcgaaaacatgactttaaagctaacacccccg