Gene CNTNAP2 Variant 1
DNA : 1646.94 KbNT_079596
mRNA : 7868 bp NM_014141
CDS : 3899 bp NP_054860
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  111 bp
acagctcctgtgttatattatatttaggataacagaattgcctaaattcctttgctaaat
attgtttcaaagatacataaaagacatatcagattcaatgattttttaaccaacacatac
caatcgttatttcgaaatcgttgttgagtgtctctctccctctctgtcttttgttttcag
AAAAATGTGATGAGCCACTTGTCTCTGGACTCCCCCATGTGGCTTTCAGCAGCTCCTCCT
CCATCTCTGGTAGCTATTCTCCCGGCTATGCCAAGATAAACAAGAGAGGAG
gtaagccaaattttgattcttttatcaataaacatgttaaataagaacatgttatattta
tagccatatatatatataatcacacaacagatgttggcagacaccagaaatcactcctgc
cacttctattaaaagatccatagatgccattaacctctcatgtaatctccacattgaaat
EXON 2  194 bp
gttaccagctggaagaatattagttgaagtcccaatggcatctataaaggatatttcata
atatatctgtgaaatagagcactgccaagaccaattaagatatgtagaatattccattgt
cagttgtacaagttcaaatttaaatattcattttcccatcttacctctgcccatcttcag
GTGCTGGGGGATGGTCTCCATCAGACAGCGACCATTATCAATGGCTTCAGGTTGACTTTG
GCAATCGGAAGCAGATCAGTGCCATTGCAACCCAAGGAAGGTATAGCAGCTCAGATTGGG
TGACCCAATACCGGATGCTCTACAGCGACACAGGGAGAAACTGGAAACCCTATCATCAAG
ATGGGAATATCTGG
gtaagtcattggcaggaaagcaaagacacagaattggattggaaatattagaaaatggta
caggatttactaagcatatatagttatcaatatttatgtattcaaatcattgggaaacta
tttattcatcattgttgatggaagaaagtttcttcaggctgtaatttctatccaatggtt
EXON 3  148 bp
cttaaaactggacctattttcacattaagagtaaggaagcagctttcttcaaattattta
cggtgtaagaaatcacaagccctaccattggatgacatttgtgtttattctagtagacag
aggacatgattgtttctaaagtatttttcccaatttttaaaatactatttccttttccag
GCATTTCCCGGAAACATTAACTCTGACGGTGTGGTCCGGCACGAATTACAGCATCCGATT
ATTGCCCGCTATGTGCGCATAGTGCCTCTGGATTGGAATGGAGAAGGTCGCATTGGACTC
AGAATTGAAGTTTATGGCTGTTCTTACT
gtgagtatcgtattgtttaaatttgtggcaggttttatctttatttaaatagtaagctgt
tttattttaaattatttaacattacttgctttctctgacaataaactaccttctcattta
catatatatgtatctatgcatagatacatatatatataataaaaggttgtgtctctattt
EXON 4  204 bp
taaaacctcctttaaaacaaacacagtaaatcaaaagaaggaatagaagaaaaacagagg
actgtcaatttctcaagaaaaacacttacttaattctcatttattctttgcagacacctg
ttggaagtggatggtaacatacatggctgaactaatatgttatttttttttttgttttag
GGGCTGATGTTATCAACTTTGATGGCCATGTTGTATTACCATATAGATTCAGAAACAAGA
AGATGAAAACACTGAAAGATGTCATTGCCTTGAACTTTAAGACGTCTGAAAGTGAAGGAG
TAATCCTGCACGGAGAAGGACAGCAAGGAGATTACATTACCTTGGAACTGAAAAAAGCCA
AGCTGGTCCTCAGTTTAAACTTAG
gtgtgttctgactgtcagttctattctttccgttatggatgttcccattaggaatatgtt
catgttgctcaattctttaaaatgtaaattataaaaagagctcatgttatatttcaattc
atacttaatctataacagtaggtatataatgaaacacctagtcattcaaaaaatatttat
EXON 5  185 bp
cagtccccagaacataaagtatttttaagtgtcgttacttactggtatcccaggttaact
cgaatggatagagctttgatggaatgtcagcctctaggtgctgtaaatgaaagatcttct
gcttcacagagttggccatagcatcattgcattgtttctttttcacttctgtgtacgcag
GAAGCAACCAGCTTGGCCCCATATATGGCCACACATCAGTGATGACAGGAAGTTTGCTGG
ATGACCACCACTGGCACTCTGTGGTCATTGAGCGCCAGGGGCGGAGCATTAACCTCACTC
TGGACAGGAGCATGCAGCACTTCCGTACCAATGGAGAGTTTGACTACCTGGACTTGGACT
ATGAG
gtacatgtgatgacgtagaaattgtaataaaatgtcaagcaattgtgtcactctcctact
gtattgtattattgttaattatattactacttacaccttttttattttcttctctaaaca
agacactgacaattttaaaaacctgattaattcgtttcattttatttctaaatttataat
EXON 6  144 bp
ctccattagacacttcaacaacaacataatttaatatgccatagattttggaggcagaat
gctataatatttgtatattttggttgaggtatagatacttgaccttcactgtattcatag
ttttgtctagttcatcataatacaatgtggacgtttacatttaatttctttttctcaaag
ATAACCTTTGGAGGCATCCCTTTCTCTGGCAAGCCCAGCTCCAGCAGTAGAAAGAATTTC
AAAGGCTGCATGGAAAGCATCAACTACAATGGCGTCAACATTACTGATCTTGCCAGAAGG
AAGAAATTAGAGCCCTCAAATGTG
gtaaggattttcacccgcaaaatattggtctataaaatatcaagtaacatttttgttttt
tggattattgaacaacaacaaaatcatgacatttttcatcatatttgtgtttgggcaaaa
tgatgtaaaacaaacattagagttatcagaattagtatagatacttgctattctttgaga
EXON 7  265 bp
tccaagtagatccgtagtggtgcatccagtcactgaatccatgctctgctgctgtgtgtg
agtttagcttaggctcaggctgtgcttcaaaacttgtagaactatactttcatcagtggt
ctgacatggatgttcattttattctgtgttttcctcagagcctgtctttctattttacag
GGAAATTTGAGCTTTTCTTGTGTGGAACCCTATACGGTGCCTGTCTTTTTCAACGCTACA
AGTTACCTGGAGGTGCCCGGACGGCTTAACCAGGACCTGTTCTCAGTCAGTTTCCAGTTT
AGGACATGGAACCCCAATGGTCTCCTGGTCTTCAGTCACTTTGCGGATAATTTGGGCAAT
GTGGAGATTGACCTCACTGAAAGCAAAGTGGGTGTTCACATCAACATCACACAGACCAAG
ATGAGCCAAATCGATATTTCCTCAG
gtcagtgaaacctatttgacatttgttcctgaaacttattgcaatttccagagttaatgt
tgtgctttgtttggttttgctggtgttacacgctcaggattaggttttaattcagatctt
caagacgcttacttggttgtagtgtgtgctgattgaataaagaaaacttggaaagttgtt
EXON 8  150 bp
gtatagaaccacttatgatgatgttaaagagacatgagacgtcagtttgaattgtaagca
gcactgtattttccaagagaaaaatacttttatttgtaaaatcgtgatttgttgattttg
gaaattgtgttcagctgggtaattttaagaaaaaaatgacttttatcttgtacttaccag
GTTCTGGGTTGAATGATGGACAGTGGCACGAGGTTCGCTTCCTAGCCAAGGAAAATTTTG
CTATTCTCACCATCGATGGAGATGAAGCATCAGCAGTTCGAACTAATAGTCCCCTTCAAG
TTAAAACTGGCGAGAAGTACTTTTTTGGAG
gtaagaatgccattcctttttggttactaatccattgcaaaaaatgaggtttcaaaatga
agtttgattatgaagtatttatatttgactcaactgactcagtagatctcatgacaaaac
aaacaaactgtaattccactgagcaaaacaaaaaaagaaaaggaaaaattttatttcttt
EXON 9  172 bp
ctctgtaataatctcactttctcaaaaaacttcctttttctacactgaatataacatcag
caaggattaaagaaacagtagttggatgtgatggctgtggccaggtagaatacccacaag
aattttagtgaaggttatactgtacaccagatttacattcccatttcttctgtttcacag
GTTTTCTGAACCAGATGAATAACTCAAGTCACTCTGTCCTTCAGCCTTCATTCCAAGGAT
GCATGCAGCTCATTCAAGTGGACGATCAACTTGTAAATTTATACGAAGTGGCACAAAGGA
AGCCGGGAAGTTTCGCGAATGTCAGCATTGACATGTGTGCGATCATAGACAG
gtaaatgatcttttcatcctacctcacgttgtccaaactttccaaacctgtgtttctgtt
gtgagaccagtgaaacatcccaaaagaaaattaaagttaaaaacaggtaaggtggaaatt
accattcaaagtacgtattgtagtatacttgtgatattagcagtgatgatgtttatgttt
EXON 10  107 bp
tgttgcgcttggcaccttctttcatgaatcatattaatctgcttaaactaacaaggatta
attgccttggtaaggcaacctggcattgaaatgatatattgcccagacagcttggaattt
ggccactcataaatctcatttgtttgttggtttatttctgtttgtctctctctctgacag
ATGTGTGCCCAATCACTGTGAGCATGGTGGAAAGTGCTCGCAAACATGGGACAGCTTCAA
ATGCACTTGTGATGAGACAGGATACAGTGGGGCCACCTGCCACAACT
gtgagtgccaatttatctcactttaatcttgtaattgcatgagaatctcaagtcttgagc
tgtgctttgaagctcagcaacctgaataatccacataatacatcactcgaatctgaaaaa
ccaagattccaattgtcatttctccaaaaaaaaaaataaaatacactattctacttgtta
EXON 11  120 bp
ggaatgcttatagagaaagaaacaaatcatgaatttaaatttagagacaaagaacactct
ttccaggaagaactactcctaactagtggtttgctagcattgcaatatgccactgggaca
tttatctggggagccatttgttctgtgctgtgcttatgtaggatattttgtttgttctag
CTATCTACGAGCCTTCCTGTGAAGCCTACAAACACCTAGGACAGACATCAAATTATTACT
GGATAGATCCTGATGGCAGCGGACCTCTGGGGCCTCTGAAAGTTTACTGCAACATGACAG

gtaactgtgtcatatttatgttttgtgaagatgcttttctatatgtcacgaataagtagt
tccaccaatggtttgtttctttggtgctgtgtttttatcacaacatctaatcagcaacat
attgctggatttgttagataagatgatgaaatgtattattagagcaataaaacattttga
EXON 12  201 bp
ctcataagcagaacttagggatgagcaaagagcagggggttttaaggattgctctcctta
acactgttctacaccagctcagtaaaaagaccatttaagtgtggctcaattattttctga
catttggagaagcatttgcatactaatgatccagggtcctggttgtttttctccccacag
AGGACAAAGTGTGGACCATAGTGTCTCATGACTTGCAGATGCAGACGCCTGTGGTCGGCT
ACAACCCAGAAAAATACTCAGTGACACAGCTCGTTTACAGCGCCTCCATGGACCAGATAA
GTGCCATCACTGACAGTGCCGAGTACTGCGAGCAGTATGTCTCCTATTTCTGCAAGATGT
CAAGATTGTTGAACACCCCAG
gtaggctgagaatggaatgttacttttaatcactatctcagctggtgcttagaattgcct
aaagaatccaacaggtgtggttcattatcttatagtctagtcttcagtaggaaggaagct
gtaaataagtaaaataaaatcattgggcttgttttctggggaatgaagctaagaaagaat
EXON 13  157 bp
agatagactgtgaagattttctcccactctgtgggttgtctgtttgaaataaattgactt
ttaagagggttgagtgatgttcagactatcagagtattcctggggaagtgggtgtaagtg
tggcagtctaatgactgaacccaggtctgtttctaaatatacctttgccttttcttgtag
ATGGAAGCCCTTACACTTGGTGGGTTGGCAAAGCCAACGAGAAGCACTACTACTGGGGAG
GCTCTGGGCCTGGAATCCAGAAATGTGCCTGCGGCATCGAACGCAACTGCACAGATCCCA
AGTACTACTGTAACTGCGACGCGGACTACAAGCAATG
gtgagtgcctgcgggcagcacagccaggctcaccctcccagtgtgcctttgtgtcaaact
catgtgatagaagaaagtttgaaaagtgctataataatacgataatagggtagaaaggtc
tggaactaacccaactgacaaatgtcaggaacatactgaaaaatataaaagcagaaagag
EXON 14  128 bp
agcaatgtgctatgagaccacctatggaagagagagaacaactctttaactgtggcttta
cttagtaaacttccaaacgattactgaaatgtcatcattagacaacgtaagcaactagca
gaaaattcatatgtctaacgcagcctcctcattctttttctgtctttccctgtgatccag
GAGGAAGGATGCTGGTTTCTTATCATACAAAGATCACCTGCCAGTGAGCCAAGTGGTGGT
TGGAGATACTGACCGTCAAGGCTCAGAAGCCAAATTGAGCGTAGGTCCTCTGCGCTGCCA
AGGAGACA
gtaagtttgcatagcagctatggcttgcactttcttatcccatttaaatattgtttccag
gctcctcagaagatgcctgcaatcagacttgctctcctgtagctcctacagaaacatcac
acaacccaagcagagataacttagaggaggggaacagccataaagcctccagtacaggag
EXON 15  171 bp
ataacttttggaaagtcaaaaatatatttgtgaggatttggtccaatgttgttcaacaga
atgagagaaaataatgactattgctaatggtacttattaaactcaagcaatgggtatctg
ttacatgactaggctgatcagggtgtgagttaacctgatttttttgttttcttcccacag
GGAATTATTGGAATGCCGCCTCTTTCCCAAACCCATCCTCCTACCTGCACTTCTCTACTT
TCCAAGGGGAAACTAGCGCTGACATTTCTTTCTACTTCAAAACATTAACCCCCTGGGGAG
TGTTTCTTGAAAATATGGGAAAGGAAGATTTCATCAAGCTGGAGCTGAAGT
gtgagtataagttgcttgtcaactcatggggagccactttcgtcacctcagggtggtccg
ggtcctgattgtggaaggccttttgattcaaacgtggaaggtttcctttgttccaggagc
aggactagaggtggacacacaagcctgagtttgggctccaacctcagtccctgtccttgg
EXON 16  219 bp
tattaatggttaatgattgacattttatccttcttccattgattttgccatcgacctttg
taggacgtgacaggcttagatgatttttcctctccctgctttgtttgtcgtctagaattt
actgctatttggtatctgggagaaaaatactcatgtttttcatgctttctgctcctccag
CTGCCACAGAAGTGTCCTTTTCATTTGATGTGGGAAATGGGCCAGTAGAGATTGTAGTGA
GGTCACCAACCCCTCTCAACGATGACCAGTGGCACCGGGTCACTGCAGAGAGGAATGTCA
AGCAGGCCAGCCTACAGGTGGACCGGCTACCGCAGCAGATCCGCAAGGCCCCAACAGAAG
GCCACACCCGCCTGGAGCTCTACAGCCAGTTATTTGTGG
gtaagtaatggaaaggtaaccatggcttccctctgttgatttttaagagcctgcacaata
caaaaaaaaaaaaaaatcagcctatgcaaggtttgatatagagatccttccaaaagtaaa
ggtgttggcctcttgtagtctccttcaagacagaatggaataaggaagaagtttcaggag
EXON 17  237 bp
gccttatagcctgcagggagaaaagcttcaactttctctatttagataggaccaacttga
tagtgacaatactagatgtgctatgcagtgtcatctcctaccacagttgttcaaaatatg
aagaattaagcaatagcagaggttattccctctgaactctgtgccttctgtcattcccag
GTGGTGCTGGGGGCCAGCAGGGCTTCCTGGGCTGCATCCGCTCCTTGAGGATGAATGGGG
TGACACTTGACCTGGAGGAAAGAGCAAAGGTCACATCTGGGTTCATATCCGGATGCTCGG
GCCATTGCACCAGCTATGGAACAAACTGTGAAAATGGAGGCAAATGCCTAGAGAGATACC
ACGGTTACTCCTGCGATTGCTCTAATACTGCATATGATGGAACATTTTGCAACAAAG
gtaaggtggaacccatttccagagccacttttgcgtgtctttttaagcccaaatcatcta
tttaatgatttttcatatgtaaacaagtgtaccttattctgaggttaagatgatcagaat
ttttctctcaacttaggtaggaattttccaaccaaaatcatttcctaatcatttttgttt
EXON 18  237 bp
ctttttttttttttgataagagtatttgtgttgatgcaatagcatctttctccatagaac
ttactcagatgcccttcctggagccagtgcctgcactccatgaactgctggagaggtcat
tgtagggtatcggcatcagacctctcctcatttttcaattctctctctcctttataacag
ATGTTGGTGCATTTTTTGAAGAAGGGATGTGGCTACGATATAACTTTCAGGCACCAGCAA
CAAATGCCAGAGACTCCAGCAGCAGAGTAGACAACGCTCCCGACCAGCAGAACTCCCACC
CGGACCTGGCACAGGAGGAGATCCGCTTCAGCTTCAGCACCACCAAGGCGCCCTGCATTC
TCCTCTACATCAGCTCCTTCACCACAGACTTCTTGGCAGTCCTCGTCAAACCCACTG
gtaaggacaaggatacccagcctctgccatttaacatttgggcagacagaatgttctagc
aagagtctatagattgttcttggtttgttatttattccccataggcttttttaagcaagt
cacataacttctttgaaccccatttctctccatgaatatcaggaaaacaacttgccagct
EXON 19  134 bp
agtgagccaagatcgcaccattgcactccagcctgggcaagagcaagactccgtcaaaaa
aaagaaagaaaagaaaagaaaggaagaaagaaagaatctaagagcaggaattgaggggat
gtgacattaaaatgaaatttagggcaaacaaattactgagctttcttttttcttctatag
GAAGCTTACAGATTCGATACAACCTGGGTGGCACCCGAGAGCCATACAATATTGACGTAG
ACCACAGGAACATGGCCAATGGACAGCCCCACAGTGTCAACATCACCCGCCACGAGAAGA
CCATCTTTCTCAAG
gtatacatacatgtacatataaattacatataatatcgcattatagtccctgtccctata
atgcttggccattggttttgttttgaggggatagaagtagaagagatgctttttacactt
tctcctacaagtgcataactagtgaagtagaaatatatataattctgacaaggaaagaca
EXON 20  94 bp
ccccagcaaaggaagacatgggtttccattttctcggggtggtgttttagagtcagtgct
gatgaaataagatatcagaaaaccagggttcaaagagtgatgtcatccccacagggaaga
tttggttccacacagggtagagacgtgcttctaaaagtgtctcttgttttcctcctgcag
CTCGATCATTATCCTTCTGTGAGTTACCATCTGCCAAGTTCATCCGACACCCTCTTCAAT
TCTCCCAAGTCGCTCTTTCTGGGAAAAGTTATAG
gtaagaatgtggttcgttaggtataaatgcgtgctacaaatacatttgggtaatgtgagt
ttggattttaaaactatcaggtaaatttctcttactggggccagtcacgaatatcttctc
tgtacaggaaagttacgtggttgttctcggtgttgcacaagcaaagcgtcaacaaattat
EXON 21  240 bp
tttaaagtcaagtatgcagccctaaatcttatcgacccattaatatttcatccaaaacaa
tgtaacatcttaaactgaaacctaaatgtaagctttggacacaagcattcaaagacaggt
atgttgtacagctggactatggtgagtcaagtaacattttcatttctttttttcttttag
AAACAGGGAAAATTGACCAAGAGATTCACAAATACAACACCCCAGGATTCACTGGTTGCC
TCTCCAGAGTCCAGTTCAACCAGATCGCCCCTCTCAAGGCCGCCTTGAGGCAGACAAACG
CCTCGGCTCACGTCCACATCCAGGGCGAGCTGGTGGAGTCCAACTGCGGGGCCTCGCCGC
TGACCCTCTCCCCCATGTCGTCCGCCACCGACCCCTGGCACCTGGATCACCTGGATTCAG

gtaaagtcttcagcaacctcaggcaggttgcttcatttctttaaacctcagtctcttggg
actatggaatggatttaataacagaacctcactggtaatgtcattggaggattaagaaag
ggcaaaggaacgttgtgagtacggagttctcagggcagcacttagcacatctgaaatact
EXON 22  81 bp
acagggatggaggctgttgtgattcttgtgggagacaatggcaagacgggtccatctgaa
atggagatttcatttgggaaaacaggaagtgttgaagagttgcatgaagaaataggtatc
aaattatttgggatcaatagtatacttgactctgacacttgactctttctttctctacag
CCAGTGCGGATTTTCCATATAATCCAGGACAAGGCCAAGCTATAAGAAATGGAGTCAACA
GAAACTCGGCTATCATTGGAG
gtaggtgatgtctagaggaggcttatatggggctactcaactatggaaagtaatagttgt
caataacatagtagtctaggaaaaaaagttttctaggtttttacattattcattttgctg
tttaaagattatgacatatgatgtgaagaaatatagtaaatatagccgggcacagtggct
EXON 23  3864 bp
tgttactccttcatggacaaaaacagacatcttacttcatttttgttatctttgttgttt
tggaggttgtgttttatatgggagagggctgtgtctgacggagctgtagtgaagtgggga
cagtgttggagggactcccaagccctgtctaacctctcgtgcttctcctttctccgtcag
GCGTCATTGCTGTGGTGATTTTCACCATCCTGTGCACCCTGGTCTTCCTGATCCGGTACA
TGTTCCGCCACAAGGGCACCTACCATACCAACGAAGCAAAGGGGGCGGAGTCGGCAGAGA
GCGCGGACGCCGCCATCATGAACAACGACCCCAACTTCACAGAGACCATTGATGAAAGCA
AAAAGGAATGGCTCATTTGAGGGGTGGCTACTTGGCTATGGGATAGGGAGGAGGGAATTA
CTAGGGAGGAGAGAAAGGGACAAAAGCACCCTGCTTCATACTCTTGAGCACATCCTTAAA
ATATCAGCACAAGTTGGGGGAGGCAGGCAATGGAATATAATGGAATATTCTTGAGACTGA
TCACAAAAAAAAAAAACCTTTTTAATATTTCTTTATAGCTGAGTTTTCCCTTCTGTATCA
AAACAAAATAATACAAAAAATGCTTTTAGAGTTTAAGCAATGGTTGAAATTTGTAGGTAA
TATCTGTCTTATTTTGTGTGTGTTTAGAGGTGTTCTAAAGACCCGTGGTAACAGGGCAAG
TTTTCTACGTTTTTAAGAGCCCTTAGAACGTGGGTATTTTTTTTCTTGAGAAAAGCTAAT
GCACCTACAGATGGCCCCCAACATTCTCTTCCTTTTGCTTCTAGTCAACCTTAATGGGCT
GTTACAGAAACTAGTTCGTGTTTATATACTATTTCCTTTGATGTCCTATAAGTCGGAAAA
GAAAGGGGCAAAGAGAACCTATTATTTGCCAGTTTTTAAGCAGAGCTCAATCTATGCCAG
CTCTCTGGCATCTGGGGTTCCTGACTGATACCAGCAGTTGAAGGAAGAGAGTGCATGGCA
CCTGGTGTGTAACGACACAATCAGCACAACTGGAGAGAGGCATTAAAGAACCAGGGAAGG
TAGTTTGATTTTTCATTGAATTCTACAAGCTAATATTGTTCCACGTATGTAGTCTTAGAC
CAATAGCTGTAACTATCAGCTGCAATACCATGGTGACCAGCTGTTACAAAAGATTTTTTC
CTGTTTTATCTGAAACATACTGGATTTATATATGTATAAGCGCCTCAATGGGGAATTAGA
GCCAGATGTTATGATTTGTTTGCTCTTTTTCTTTTATAGTTATAGCAAAAATATGGATAA
TTTCTAGTGAATGCATAAATTAGGTTGCGTTTCTTATTTTGCTTTAAATCTCTGGTAGTT
TTTCCACCCCTGTGACACAATCCTAATAGACAGTGTCCTGTAAATGGACACAACACAATA
AAGTCAAGTTATTATTGCTGTTACTCTGGATGATATGGAAAACACTGCCATATTTTAAAT
CAACTACTCCACGTGTTTTTCCATCCAATCACACTGCTGTGATTCAGGGATCTTTCTTCT
AAAACGGACACATTTGAACCTCAGGTTCATCACAAACCTGGTACCTGTTGCTTCCCAGAG
GATGGAGAAGTGTAGTTAATCACACCTCTTAGTTTAATCTGAAATCTTGACCCAGTTATT
TAACAAATAAATACCTCATTGATTATATTTAAAAGTAATACACTTCCTGTAAACAAATGG
GGACAATGCATCCAAAAAATCTTTTTAAACAGATTACACAAAAATTATTTCCAGAAAGGC
TACCATTTATCATCATTATATTTCAAGCCTCTTATACTTAATAAGCACTTTCTAAAAAGT
CTTGAGATCCCACCATTCTGAGGAATTCAATATGATCACTTTTTCCTTCTTTGCCTGGGA
GAGGTTAAGAGGCGGTTTCGAAGGTATAGATGCTATTGTTCTGATGGCCCGGCTGAATAA
AATGGAAATTCTAGTTTGTTAGAATTATGCATTCTTTTTCAAGATTCTCAGTGTGCCTAA
CTTATTGGAGCACATCAGTTTCTTGGGTAATGGAAAACATTACCTAGAGTTGCCAGTGGC
ACATTACACCAGTACAGAGCACATTCCAAAGGAGACATTGGACCAGTTAATTCCCATACA
AGTCAAGGTAACAGAACAAAAGGGAATCCTGATGCCCTTTTACCATTGCTGGTTGAGCTC
AGGCACTGTCATGGACACCCTTAATTTTAAAAGGTTTTAATCATTCTTCTATAAAATACA
TTTAAAATGGAAAAATACTTAATATCACTAAATATCAGAACAATGTAACATTTACAAATG
ACATATTGAAAGCAAAGGCTGTTTTATTTAGCCAAGATGATTACCATTAGGAGTTACTTT
ATGTATTGTTGAAAGCAAATTTTAAACATGATGTTTTAGAAGTGTTTCTGATTTTTAAAC
CTGGTTTACAGGTATTACTTCTGCACTTACCAAATAATGCCAGATGGAAATTTATTATTT
CTTGCAATTCCCATGATAGCTCTGTTCTTTATGCATTGTCTCAACACTTTCCCTTTTTTC
CCAAAATGAGTAGAGAATTAAAGCCACCCAAAACAGCTTCTGCTACTAAAATGTTCTCAT
CCTTTCTCCTCCCTCTCCTTTTCCTGCCACAAAAGGTGAAAAATGAGATCCAATCCTCTC
ACCAAAATTTCAAACCTAGGACACTGGAATGACTGCAGGGATCAGTGGTTCTCCCATATC
ACCATCAATTAAGACATATAGGACACTGTCTTCCTTCAAGAGGGTTACAATGTGGCCATC
AGACAGGAAACCAAACGGTGGATAAAGTATTAAGTAACTAAGTGCCAAATAAATGCTGGA
AATCTTGACCTCTCCTTGGGATTATGGGTGTAACAAAAATCCCTACATCTGTTTATGAAG
GCCATATTCAGTACATTTTAAATGGTAAATAATCTGTTTATGTGAAGAAAAAGAATTAAG
TCTTTCTTCCAACTCTCTCCTTGGATAGCCTAGCACAGTGCAGCCTCCATAACCATGACA
TTCCCGCCCAAGCTCTCAGTGCCTAATCCTGCTTTGTCATTCACATCTCACAAAATCTTG
ACATCTTACATTCCAATACATTATCAAGCAAGCACAAGTATGCTGGTAGTAGCCTCTTTA
AATAATATGTATAGACAACAACAACGACAAAAAATAGACTGTTTTAAAGTTTCAGGGAAA
GTTGGTGGCTGATTTAAAGTTGTGCAGGAAACATCTTCTGTGTATGAAGCAAATGTCGAT
GTTTTGAAAAGCTAGGAGATGACTTTGAATGAATGCAAGGTTAGTGAGATCCTAAGCTCT
CAAAATAGCATATTCCCTAGAGCTCAAGAAAGCTGGTCCAGGAGGTTGAAAAAGCTATTT
TGTTGTTAAATTATTTTCTGGCCCTTCTTAATATTTAAAAATGTATTTCCCCTTGTGGCT
TTCAACCACCTGCTCAAAAAAAGAGACTTGTTACATGAAAGTTTTCATTAAAGAGCTGAA
AACAAGAATTTAGAGAGCCATTCCTAGAAAATGTCCTACTGCCCTGCATTTGACAAACAA
GCATCCTTTACTAACAAGAGCAGGAATTCAGAGGCACAAGAAAAAGCATTGGCATGAGCC
AAAGAGTCTGTCTTAATGTTACTTTTGAAAATCTGCTGAGCGGCCACCATATGCAGGCTG
AGAGCTGGGCACAGGCGAAGCCATTGGAAGCACTTCAGGAACAAGCACACAGCTGTGGGA
CTTGAACATGCAAGTGTTCAGGTTGTGTCAAGAAGCTTTTCTTTCCTTCTATGATGGAAT
CTGTTCTTTTCTATCCTACTTTTTTCTCTCTTCCTCTCCTCACCACATTATACCCTGCTC
TTACGCAGTAAACGTTTTAATGGCCCGTTTATGTCTCATGCCTCCAAACAACACTGAATT
TGAAACCCCCCATTTTTTCTTTTCACCACCCTGTTGAGCAATTTTCCCAAAAAAAGGGCA
GCAATTATTAAATTGAATTCAAGT
aagccagccaaagataggtcctaaattgctagtcccagtagaaccacctgatcctaaacc
agtgcgaaacaaacagtaacaatgtccccagctgacttcagctaagaaccaatggctcct
acccccgccccgcttttttttgttgttttttgttttgttttgagacggagtcttgctctg
EXON 24  305 bp
acatgtattaatatacagcacgcatttacaagtttattttccagataaaattgtgctata
agaacagctctaccaagacagtctgcaccatttccaagtctcagttaatttacagcaact
gctgctttcggagatggctgtgaaaatatggaagttcctctcaagtaggccaagaaacag
TTCTAGATTTTACTAAGTTTTATTTTGTCAGGTTTTTTAAATTTTTTCAGTGAGCGTGGT
GACTGCAGAGGTTAGTGCTGTGAAAAGCTGGGCTAAATATTCTTTCTGTAAAGTCAAACA
GGATTCCATCCCCTGTGAAATAACACAAAATTTCACTCTCTAAAAGCAACAGCATGTAAA
CTAGAATGAAAGAAGGAAATTATGTACGTATGCCTAATATTCTTTGTGAATGTCTTTCAT
TTAACTAAAATTATATTAGAAACCAGATTGATAAATAAAAAATTCAAAGTAGTTTTAATT
ATCCT
aaaagcgattcttcgtgttttgtaccacttgtctctcttaagagcaattttcaaccttca
gcaaaagttaagttccaagcactgaaatataagcctactgagaatatcgtctttccacaa
gttgtggagatatagtcactcctaaaaggtctgatttgggtacgtccatggttaacctcc