Gene CLDN3 Variant 1
DNA : 1.25 KbNT_079593
mRNA : 1249 bp NM_001306
CDS : 663 bp NP_001297
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  1249 bp
cgcagggccaagtccttcctcccaggacgctcggtgaaggtgggaggcaggggccacgtc
actgtccttaggccctggagagcgcggctccgcccctaccgcccccaccggagcgctggg
cacttagctaagacgcaccggccccagcccagggccagcccagtcgccgccgcccgccca
CAAAGCCACAGGCAGGTGCAGGCGCAGCCGCGGCGAGAGCGTATGGAGCCGAGCCGTTAG
CGCGCGCCGTCGGTGAGTCAGTCCGTCCGTCCGTCCGTCCGTCGGGGCGCCGCAGCTCCC
GCCAGGCCCAGCGGCCCCGGCCCCTCGTCTCCCCGCACCCGGAGCCACCCGGTGGAGCGG
GCCTTGCCGCGGCAGCCATGTCCATGGGCCTGGAGATCACGGGCACCGCGCTGGCCGTGC
TGGGCTGGCTGGGCACCATCGTGTGCTGCGCGTTGCCCATGTGGCGCGTGTCGGCCTTCA
TCGGCAGCAACATCATCACGTCGCAGAACATCTGGGAGGGCCTGTGGATGAACTGCGTGG
TGCAGAGCACCGGCCAGATGCAGTGCAAGGTGTACGACTCGCTGCTGGCACTGCCACAGG
ACCTTCAGGCGGCCCGCGCCCTCATCGTGGTGGCCATCCTGCTGGCCGCCTTCGGGCTGC
TAGTGGCGCTGGTGGGCGCCCAGTGCACCAACTGCGTGCAGGACGACACGGCCAAGGCCA
AGATCACCATCGTGGCAGGCGTGCTGTTCCTTCTCGCCGCCCTGCTCACCCTCGTGCCGG
TGTCCTGGTCGGCCAACACCATTATCCGGGACTTCTACAACCCCGTGGTGCCCGAGGCGC
AGAAGCGCGAGATGGGCGCGGGCCTGTACGTGGGCTGGGCGGCCGCGGCGCTGCAGCTGC
TGGGGGGCGCGCTGCTCTGCTGCTCGTGTCCCCCACGCGAGAAGAAGTACACGGCCACCA
AGGTCGTCTACTCCGCGCCGCGCTCCACCGGCCCGGGAGCCAGCCTGGGCACAGGCTACG
ACCGCAAGGACTACGTCTAAGGGACAGACGCAGGGAGACCCCACCACCACCACCACCACC
AACACCACCACCACCACCGCGAGCTGGAGCGCGCACCAGGCCATCCAGCGTGCAGCCTTG
CCTCGGAGGCCAGCCCACCCCCAGAAGCCAGGAAGCCCCCGCGCTGGACTGGGGCAGCTT
CCCCAGCAGCCACGGCTTTGCGGGCCGGGCAGTCGACTTCGGGGCCCAGGGACCAACCTG
CATGGACTGTGAAACCTCACCCTTCTGGAGCACGGGGCCTGGGTGACCGCCAATACTTGA
CCACCCCGTCGAGCCCCATCGGGCCGCTGCCCCCATGCTCGCGCTGGGCAGGGACCGGCA
GCCCTGGAAGGGGCACTTGATATTTTTCAATAAAAGCCTTTCGTTTTGC
actcgctggagcctccttgttcccagcgcctccacctccctgcagagctccccctcgggg
cggccttggctggatctcgctctcccggatggagcttagagggaagatggggttgtaagc
tgagcttggtgatggcggggtggtcacttgcccactccctggggattcggaagacagcct