Gene CFTR Variant 1
DNA : 188.70 KbNT_079596
mRNA : 6128 bp NM_000492
CDS : 4443 bp NP_000483
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  185 bp
cgaaggaggagaggaggaaggagcgggaggggtgctggcgggggtgcgtagtgggtggag
aaagccgctagagcaaatttggggccggaccaggcagcactcggcttttaacctgggcag
tgaaggcgggggaaagagcaaaaggaaggggtggtgtgcggagtaggggtgggtgggggg
AATTGGAAGCAAATGACATCACAGCAGGTCAGAGAAAAAGGGTTGAGCGGCAGGCACCCA
GAGTAGTAGGTCTTTGGCATTAGGAGCTTGAGCCCAGACGGCCCTAGCAGGGACCCCAGC
GCCCGAGAGACCATGCAGAGGTCGCCTCTGGAAAAGGCCAGCGTTGTCTCCAAACTTTTT
TTCAG
gtgagaaggtggccaaccgagcttcggaaagacacgtgcccacgaaagaggagggcgtgt
gtatgggttgggtttggggtaaaggaataagcagtttttaaaaagatgcgctatcattca
ttgttttgaaagaaaatgtgggtattgtagaataaaacagaaagcattaagaagagatgg
EXON 2  111 bp
ttttatacaggtgtagcctgtaagagatgaagcctggtatttatagaaattgacttattt
tattctcatatttacatgtgcataattttccatatgccagaaaagttgaatagtatcaga
ttccaaatctgtatggagaccaaatcaagtgaatatctgttcctcctctctttattttag
CTGGACCAGACCAATTTTGAGGAAAGGATACAGACAGCGCCTGGAATTGTCAGACATATA
CCAAATCCCTTCTGTTGATTCTGCTGACAATCTATCTGAAAAATTGGAAAG
gtatgttcatgtacattgtttagttgaagagagaaattcatattattaattatttagaga
agagaaagcaaacatattataagtttaattcttatatttaaaaataggagccaagtatgg
tggctaatgcctgtaatcccaactatttgggaggccaagatgagaggattgcttgagacc
EXON 3  109 bp
ttctgccaaatatctggctgagtgtttggtgttgtatggtctccatgagattttgtctct
ataatacttgggttaatctccttggatatacttgtgtgaatcaaactatgttaagggaaa
taggacaactaaaatatttgcacatgcaacttattggtcccactttttattcttttgcag
AGAATGGGATAGAGAGCTGGCTTCAAAGAAAAATCCTAAACTCATTAATGCCCTTCGGCG
ATGTTTTTTCTGGAGATTTATGTTCTATGGAATCTTTTTATATTTAGGG
gtaaggatctcatttgtacattcattatgtatcacataactatattcatttttgtgatta
tgaaaagactacgaaatctggtgaataggtgtaaaaatataaaggatgaatccaactcca
aacactaagaaaccacctaaaactctagtaaggataagtaaaaatcctttggaactaaaa
EXON 4  216 bp
agtcttatttcaaagtaccaagatattgaaaatagtgctaagagtttcacatatggtatg
accctctatataaactcattttaagtctcctctaaagatgaaaagtcttgtgttgaaatt
ctcagggtattttatgagaaataaatgaaatttaatttctctgtttttccccttttgtag
GAAGTCACCAAAGCAGTACAGCCTCTCTTACTGGGAAGAATCATAGCTTCCTATGACCCG
GATAACAAGGAGGAACGCTCTATCGCGATTTATCTAGGCATAGGCTTATGCCTTCTCTTT
ATTGTGAGGACACTGCTCCTACACCCAGCCATTTTTGGCCTTCATCACATTGGAATGCAG
ATGAGAATAGCTATGTTTAGTTTGATTTATAAGAAG
gtaatacttccttgcacaggccccatggcacatatattctgtatcgtacatgttttaatg
tcataaattaggtagtgagctggtacaagtaagggataaatgctgaaattaatttaatat
gcctattaaataaatggcaggaataattaatgctcttaattatccttgataatttaattg
EXON 5  90 bp
ctgttgaaagaaacatttatgaacctgagaagatagtaagctagatgaatagaatataat
tttcattacctttacttaataatgaatgcataataactgaattagtcatattataatttt
acttataatatatttgtattttgtttgttgaaattatctaactttccatttttcttttag
ACTTTAAAGCTGTCAAGCCGTGTTCTAGATAAAATAAGTATTGGACAACTTGTTAGTCTC
CTTTCCAACAACCTGAACAAATTTGATGAA
gtatgtacctattgatttaatcttttaggcactattgttataaattatacaactggaaag
gcggagttttcctgggtcagataatagtaattagtggttaagtcttgctcagctctagct
tccctattctggaaactaagaaaggtcaattgtatagcagagcaccattctggggtctgg
EXON 6  164 bp
aatgtttaagcacattgctatgtgctccatgtaatgattacctagattttagtgtgctca
gaaccacgaagtgtttgatcatataagctccttttacttgctttctttcatatatgattg
ttagtttctaggggtggaagatacaatgacacctgtttttgctgtgcttttattttccag
GGACTTGCATTGGCACATTTCGTGTGGATCGCTCCTTTGCAAGTGGCACTCCTCATGGGG
CTAATCTGGGAGTTGTTACAGGCGTCTGCCTTCTGTGGACTTGGTTTCCTGATAGTCCTT
GCCCTTTTTCAGGCTGGGCTAGGGAGAATGATGATGAAGTACAG
gtagcaacctattttcataacttgaaagttttaaaaattatgttttcaaaaagcccactt
tagtaaaaccaggactgctctatgcatagaacagtgatcttcagtgtcattaaatttttt
ttttttttttttttttgagacagagtctagatctgtcacccaggctggagtgcagtggca
EXON 7  126 bp
cacataggaggcatttaccaaacagtagttattatttttgttaccatctatttgataata
aaataatgcccatctgttgaataaaagaaatatgacttaaaaccttgagcagttcttaat
agataatttgacttgtttttactattagattgattgattgattgattgattgatttacag
AGATCAGAGAGCTGGGAAGATCAGTGAAAGACTTGTGATTACCTCAGAAATGATTGAAAA
TATCCAATCTGTTAAGGCATACTGCTGGGAAGAAGCAATGGAAAAAATGATTGAAAACTT
AAGACA
gtaagttgttccaataatttcaatattgttagtaattctgtccttaattttttaaaaata
tgtttatcatggtagacttccacctcatatttgatgtttgtgacaatcaaatgattgcat
ttaagttctgtcaatattcatgcattagttgcacaaattcactttcatgggctgtagttt
EXON 8  247 bp
actgaggcccagagagattaaataacatgcccaaggtcacacaggtcatatgatgtggag
ccaggttaaaaatataggcagaaagactctagagaccatgctcagatcttccattccaag
atccctgatatttgaaaaataaaataacatcctgaattttattgttattgttttttatag
AACAGAACTGAAACTGACTCGGAAGGCAGCCTATGTGAGATACTTCAATAGCTCAGCCTT
CTTCTTCTCAGGGTTCTTTGTGGTGTTTTTATCTGTGCTTCCCTATGCACTAATCAAAGG
AATCATCCTCCGGAAAATATTCACCACCATCTCATTCTGCATTGTTCTGCGCATGGCGGT
CACTCGGCAATTTCCCTGGGCTGTACAAACATGGTATGACTCTCTTGGAGCAATAAACAA
AATACAG
gtaatgtaccataatgctgcattatatactatgatttaaataatcagtcaatagatcagt
tctaatgaactttgcaaaaatgtgcgaaaagatagaaaaagaaatttccttcactaggaa
gttataaaagttgccagctaatactaggaatgttcaccttaaacttttcctagcatttct
EXON 9  93 bp
cctagtgcttggcaaattaactttagaacactaataaaattattttattaagaaataatt
actatttcattattaaaattcatatataagatgtagcacaatgagagtataaagtagatg
taataatgcattaatgctattctgattctataatatgtttttgctctcttttataaatag
GATTTCTTACAAAAGCAAGAATATAAGACATTGGAATATAACTTAACGACTACAGAAGTA
GTGATGGAGAATGTAACAGCCTTCTGGGAGGAG
gtcagaatttttaaaaaattgtttgctctaaacacctaactgttttcttctttgtgaata
tggatttcatcctaatggcgaataaaattagaatgatgatataactggtagaactggaag
gaggatcactcacttattttctagattaagaagtagaggaatggccaggtgctcatggtt
EXON 10  183 bp
ctagaaaccgtatgctatataattatgtactataaagtaataatgtatacagtgtaatgg
atcatgggccatgtgcttttcaaactaattgtacataaaacaagcatctattgaaaatat
ctgacaaactcatcttttatttttgatgtgtgtgtgtgtgtgtgtgtgtttttttaacag
GGATTTGGGGAATTATTTGAGAAAGCAAAACAAAACAATAACAATAGAAAAACTTCTAAT
GGTGATGACAGCCTCTTCTTCAGTAATTTCTCACTTCTTGGTACTCCTGTCCTGAAAGAT
ATTAATTTCAAGATAGAAAGAGGACAGTTGTTGGCGGTTGCTGGATCCACTGGAGCAGGC
AAG
gtagttcttttgttcttcactattaagaacttaatttggtgtccatgtctcttttttttt
ctagtttgtagtgctggaaggtatttttggagaaattcttacatgagcattaggagaatg
tatgggtgtagtgtcttgtataatagaaattgttccactgataatttactctagtttttt
EXON 11  192 bp
gtatcttttgtgcatagcagagtacctgaaacaggaagtattttaaatattttgaatcaa
atgagttaatagaatctttacaaataagaatatacacttctgcttaggatgataattgga
ggcaagtgaatcctgagcgtgatttgataatgacctaataatgatgggttttatttccag
ACTTCACTTCTAATGGTGATTATGGGAGAACTGGAGCCTTCAGAGGGTAAAATTAAGCAC
AGTGGAAGAATTTCATTCTGTTCTCAGTTTTCCTGGATTATGCCTGGCACCATTAAAGAA
AATATCATCTTTGGTGTTTCCTATGATGAATATAGATACAGAAGCGTCATCAAAGCATGC
CAACTAGAAGAG
gtaagaaactatgtgaaaactttttgattatgcatatgaacccttcacactacccaaatt
atatatttggctccatattcaatcggttagtctacatatatttatgtttcctctatgggt
aagctactgtgaatggatcaattaataaaacacatgacctatgctttaagaagcttgcaa
EXON 12  95 bp
atgttgtttttgaccaactaaataaattgcatttgaaataatggagatgcaatgttcaaa
atttcaactgtggttaaagcaatagtgtgatatatgattacattagaaggaagatgtgcc
tttcaaattcagattgagcatactaaaagtgactctctaattttctatttttggtaatag
GACATCTCCAAGTTTGCAGAGAAAGACAATATAGTTCTTGGAGAAGGTGGAATCACACTG
AGTGGAGGTCAACGAGCAAGAATTTCTTTAGCAAG
gtgaataactaattattggtctagcaagcatttgctgtaaatgtcattcatgtaaaaaaa
ttacagacatttctctattgctttatattctgtttctggaattgaaaaaatcctggggtt
ttatggctagtgggttaagaatcacatttaagaactataaataatggtatagtatccaga
EXON 13  87 bp
atagtaaaaacatgtataaaagtgctacttctgcaccacttttgagaatagtgttatttc
agtgaatcgatgtggtgaccatattgtaatgcatgtagtgaactgtttaaggcaaatcat
ctacactagatgaccaggaaatagagaggaaatgtaatttaatttccattttctttttag
AGCAGTATACAAAGATGCTGATTTGTATTTATTAGACTCTCCTTTTGGATACCTAGATGT
TTTAACAGAAAAAGAAATATTTGAAAG
gtatgttctttgaataccttacttataatgctcatgctaaaataaaagaaagacagactg
tcccatcatagattgcattttacctcttgagaaatatgttcaccattgttggtatggcag
aatgtagcatggtattaactcaaatctgatctgccctactgggccaggattcaagattac
EXON 14  724 bp
atcagaattcacaaggtaccaatttaattactacagagtacttatagaatcatttaaaat
ataataaaattgtatgatagagattatatgcaataaaacattaacaaaatgctaaaatac
gagacatattgcaataaagtatttataaaattgatatttatatgtttttatatcttaaag
CTGTGTCTGTAAACTGATGGCTAACAAAACTAGGATTTTGGTCACTTCTAAAATGGAACA
TTTAAAGAAAGCTGACAAAATATTAATTTTGCATGAAGGTAGCAGCTATTTTTATGGGAC
ATTTTCAGAACTCCAAAATCTACAGCCAGACTTTAGCTCAAAACTCATGGGATGTGATTC
TTTCGACCAATTTAGTGCAGAAAGAAGAAATTCAATCCTAACTGAGACCTTACACCGTTT
CTCATTAGAAGGAGATGCTCCTGTCTCCTGGACAGAAACAAAAAAACAATCTTTTAAACA
GACTGGAGAGTTTGGGGAAAAAAGGAAGAATTCTATTCTCAATCCAATCAACTCTATACG
AAAATTTTCCATTGTGCAAAAGACTCCCTTACAAATGAATGGCATCGAAGAGGATTCTGA
TGAGCCTTTAGAGAGAAGGCTGTCCTTAGTACCAGATTCTGAGCAGGGAGAGGCGATACT
GCCTCGCATCAGCGTGATCAGCACTGGCCCCACGCTTCAGGCACGAAGGAGGCAGTCTGT
CCTGAACCTGATGACACACTCAGTTAACCAAGGTCAGAACATTCACCGAAAGACAACAGC
ATCCACACGAAAAGTGTCACTGGCCCCTCAGGCAAACTTGACTGAACTGGATATATATTC
AAGAAGGTTATCTCAAGAAACTGGCTTGGAAATAAGTGAAGAAATTAACGAAGAAGACTT
AAAG
gtaggtatacatcgcttgggggtatttcaccccacagaatgcaattgagtagaatgcaat
atgtagcatgtaacaaaatttactaaaatcataggattaggataaggtgtatcttaaaac
tcagaaagtatgaagttcattaattatacaagcaacgttaaaatgtaaaataacaaatga
EXON 15  129 bp
tagacattattctggctatagaatgacatcatacatggcatttataatgatttatatttg
ttaaaatacacttagattcaagtaatactattcttttattttcatatattaaaaataaaa
ccacaatggtggcatgaaactgtactgtcttattgtaatagccataattcttttattcag
GAGTGCTTTTTTGATGATATGGAGAGCATACCAGCAGTGACTACATGGAACACATACCTT
CGATATATTACTGTCCACAAGAGCTTAATTTTTGTGCTAATTTGGTGCTTAGTAATTTTT
CTGGCAGAG
gtaagaatgttctattgtaaagtattactggatttaaagttaaattaagatagtttgggg
atgtatacatatatatgcacacacataaatatgtatatatacacatgtatacatgtataa
gtatgcatatatacacacatatatcactatatgtatatatgtatatattacatatatttg
EXON 16  38 bp
gtacttagaacacctagtacagctgctggacccaggaacacaaagcaaaggaagatgaaa
ttgtgtgtaccttgatattggtacacacatcaaatggtgtgatgtgaatttagatgtggg
catgggaggaataggtgaagatgttagaaaaaaaatcaactgtgtcttgttccattccag
GTGGCTGCTTCTTTGGTTGTGCTGTGGCTCCTTGGAAA
gtgagtattccatgtcctattgtgtagattgtgttttatttctgttgattaaatattgta
atccactatgtttgtatgtattgtaatccactttgtttcatttctcccaagcattatggt
agtggaaagataaggttttttgtttaaatgatgaccattagttgggtgaggtgacacatt
EXON 17  251 bp
atagtgagaaaacatatctattttcttgcaataatagtatgattttgaggttaagggtgc
atgctcttctaatgcaaaatattgtatttatttagactcaagtttagttccatttacatg
tattggaaattcagtaagtaactttggctgccaaataacgatttcctatttgctttacag
CACTCCTCTTCAAGACAAAGGGAATAGTACTCATAGTAGAAATAACAGCTATGCAGTGAT
TATCACCAGCACCAGTTCGTATTATGTGTTTTACATTTACGTGGGAGTAGCCGACACTTT
GCTTGCTATGGGATTCTTCAGAGGTCTACCACTGGTGCATACTCTAATCACAGTGTCGAA
AATTTTACACCACAAAATGTTACATTCTGTTCTTCAAGCACCTATGTCAACCCTCAACAC
GTTGAAAGCAG
gtactttactaggtctaagaaatgaaactgctgatccaccatcaatagggcctgtggttt
tgttggttttctaatggcagtgctggcttttgcacagaggcatgtgccctttgttgaacc
tccatttgactggcatgcacatgtctcagatattataggttatcatatattgttgctcct
EXON 18  80 bp
acataattatttagaatgtttggaaagaaacaaaaatttctaagtctatctgattctatt
tgctaattcttatttgggttctgaatgcgtctactgtgatccaaacttagtattgaatat
attgatatatctttaaaaaattagtgttttttgaggaatttgtcatcttgtatattatag
GTGGGATTCTTAATAGATTCTCCAAAGATATAGCAATTTTGGATGACCTTCTGCCTCTTA
CCATATTTGACTTCATCCAG
gtatgtaaaaataagtaccgttaagtatgtctgtattattaaaaaaacaataacaaaagc
aaatgtgattttgttttcattttttatttgattgagggttgaagtcctgtctattgcatt
aattttgtaattatccaaagccttcaaaatagacataagtttagtaaattcaataataag
EXON 19  151 bp
aactaacctgcacaatgtgcacatgtaccctaaaacttaaagtataataaaaaaaataaa
aaaaagtttgaggtgtttaaagtatgcaaaaaaaaaaaaagaaataaatcactgacacac
tttgtccactttgcaatgtgaaaatgtttactcaccaacatgttttctttgatcttacag
TTGTTATTAATTGTGATTGGAGCTATAGCAGTTGTCGCAGTTTTACAACCCTACATCTTT
GTTGCAACAGTGCCAGTGATAGTGGCTTTTATTATGTTGAGAGCATATTTCCTCCAAACC
TCACAGCAACTCAAACAACTGGAATCTGAAG
gtatgacagtgaatgtgcgatactcatcttgtaaaaaagctataagagctatttgagatt
ctttattgttaatctacttaaaaaaaattctgcttttaaacttttacatcatataacaat
aatttttttctacatgcatgtgtatataaaaggaaactatattacaaagtacacatggat
EXON 20  228 bp
attaataaaataacaaatcatatctattcaaagaatggcaccagtgtgaaaaaaagcttt
ttaaccaatgacatttgtgatatgattattctaatttagtctttttcaggtacaagatat
tatgaaattacattttgtgtttatgttatttgcaatgttttctatggaaatatttcacag
GCAGGAGTCCAATTTTCACTCATCTTGTTACAAGCTTAAAAGGACTATGGACACTTCGTG
CCTTCGGACGGCAGCCTTACTTTGAAACTCTGTTCCACAAAGCTCTGAATTTACATACTG
CCAACTGGTTCTTGTACCTGTCAACACTGCGCTGGTTCCAAATGAGAATAGAAATGATTT
TTGTCATCTTCTTCATTGCTGTTACCTTCATTTCCATTTTAACAACAG
gtactatgaactcattaactttagctaagcatttaagtaaaaaattttcaatgaataaaa
tgctgcattctataggttatcaatttttgatatctttagagtttagtaattaacaaattt
gttggtttattattgaacaagtgatttctttgaatttccattgttttattgttaaacaaa
EXON 21  101 bp
tgcagagcattattctattagtagatgctgtgatgaactgagatttaaaaattgttaaaa
ttagcataaaattgaaatgtaaatttaatgtgatatgtgccctaggagaagtgtgaataa
agtcgttcacagaagagagaaataacatgaggttcatttacgtcttttgtgcatctatag
GAGAAGGAGAAGGAAGAGTTGGTATTATCCTGACTTTAGCCATGAATATCATGAGTACAT
TGCAGTGGGCTGTAAACTCCAGCATAGATGTGGATAGCTTG
gtaagtcttatcatctttttaacttttatgaaaaaaattcagacaagtaacaaagtatga
gtaatagcatgaggaagaactatataccgtatattgagcttaagaaataaaacattacag
ataaattgagggtcactgtgtatctgtcattaaatccttatctcttctttccttctcata
EXON 22  249 bp
ttcagttaaacttttaattatatccaattatttcctgttagttcattgaaaagcccgaca
aataaccaagtgacaaatagcaagtgttgcattttacaagttattttttaggaagcatca
aactaattgtgaaattgtctgccattcttaaaaacaaaaatgttgttatttttatttcag
ATGCGATCTGTGAGCCGAGTCTTTAAGTTCATTGACATGCCAACAGAAGGTAAACCTACC
AAGTCAACCAAACCATACAAGAATGGCCAACTCTCGAAAGTTATGATTATTGAGAATTCA
CACGTGAAGAAAGATGACATCTGGCCCTCAGGGGGCCAAATGACTGTCAAAGATCTCACA
GCAAAATACACAGAAGGTGGAAATGCCATATTAGAGAACATTTCCTTCTCAATAAGTCCT
GGCCAGAGG
gtgagatttgaacactgcttgctttgttagactgtgttcagtaagtgaatcccagtagcc
tgaagcaatgtgttagcagaatctatttgtaacattattattgtacagtagaatcaatat
taaacacacatgttttattatatggagtcattatttttaatatgaaatttaatttgcaga
EXON 23  156 bp
atatatcaacattggtcaggattgaaagtgtgcaacaaggtttgaatgaataagtgaaaa
tcttccactggtgacaggataaaatattccaatggtttttattgaagtacaatactgaat
tatgtttatggcatggtacctatatgtcacagaagtgatcccatcacttttaccttatag
GTGGGCCTCTTGGGAAGAACTGGATCAGGGAAGAGTACTTTGTTATCAGCTTTTTTGAGA
CTACTGAACACTGAAGGAGAAATCCAGATCGATGGTGTGTCTTGGGATTCAATAACTTTG
CAACAGTGGAGGAAAGCCTTTGGAGTGATACCACAG
gtgagcaaaaggacttagccagaaaaaaggcaactaaattatattttttactgctatttg
atacttgtactcaagaaattcatattactctgcaaaatatatttgttatgcattgctgtc
ttttttctccagtgcagttttctcataggcagaaaagatgtctctaaaagtttggaattc
EXON 24  90 bp
gaatgatacaaagcagacatgataaaatattaaaatttgagagaacttgatggtaagtac
atgggtgtttcttattttaaaataatttttctacttgaaatattttacaatacaataagg
gaaaaataaaaagttatttaagttattcatactttcttcttcttttcttttttgctatag
AAAGTATTTATTTTTTCTGGAACATTTAGAAAAAACTTGGATCCCTATGAACAGTGGAGT
GATCAAGAAATATGGAAAGTTGCAGATGAG
gtaaggctgctaactgaaatgattttgaaaggggtaactcataccaacacaaatggctga
tatagctgacatcattctacacactttgtgtgcatgtatgtgtgtgcacaactttaaaat
ggagtaccctaacatacctggagcaacaggtacttttgactggacctacccctaactgaa
EXON 25  173 bp
tgagctgtcaaggttgtaaatagacttttgctcaatcaattcaaatggtggcaggtagtg
ggggtagagggattggtatgaaaaacataagctttcagaactcctgtgtttatttttaga
atgtcaactgcttgagtgtttttaactctgtggtatctgaactatcttctctaactgcag
GTTGGGCTCAGATCTGTGATAGAACAGTTTCCTGGGAAGCTTGACTTTGTCCTTGTGGAT
GGGGGCTGTGTCCTAAGCCATGGCCACAAGCAGTTGATGTGCTTGGCTAGATCTGTTCTC
AGTAAGGCGAAGATCTTGCTGCTTGATGAACCCAGTGCTCATTTGGATCCAGT
gtgagtttcagatgttctgttacttaatagcacagtgggaacagaatcattatgcctgct
tcatggtgacacatatttctattaggctgtcatgtctgcgtgtgggggtctcccccaaga
tatgaaataattgcccagtggaaatgagcataaatgcatatttccttgctaagagtcttg
EXON 26  106 bp
ttagagtctaccccatggttgaaaagctgattgtggctaacgctatatcaacattatgtg
aaaagaacttaaagaaataagtaatttaaagagataatagaacaatagacatattatcaa
ggtaaatacagatcattactgttctgtgatattatgtgtggtattttctttcttttctag
AACATACCAAATAATTAGAAGAACTCTAAAACAAGCATTTGCTGATTGCACAGTAATTCT
CTGTGAACACAGGATAGAAGCAATGCTGGAATGCCAACAATTTTTG
gtgagtctttataactttacttaagatctcattgcccttgtaattcttgataacaatctc
acatgtgatagttcctgcaaattgcaacaatgtacaagttcttttcaaaaatatgtatca
tacagccatccagctttactcaaaatagctgcacaagtttttcactttgatctgagccat
EXON 27  1754 bp
aacctccttagagcaaaaggacacagcagttaaatgtgacatacctgattgttcaaaatg
caaggctctggacattgcattctttgacttttattttcctttgagcctgtgccagtttct
gtccctgctctggtctgacctgccttctgtcccagatctcactaacagccatttccctag
GTCATAGAAGAGAACAAAGTGCGGCAGTACGATTCCATCCAGAAACTGCTGAACGAGAGG
AGCCTCTTCCGGCAAGCCATCAGCCCCTCCGACAGGGTGAAGCTCTTTCCCCACCGGAAC
TCAAGCAAGTGCAAGTCTAAGCCCCAGATTGCTGCTCTGAAAGAGGAGACAGAAGAAGAG
GTGCAAGATACAAGGCTTTAGAGAGCAGCATAAATGTTGACATGGGACATTTGCTCATGG
AATTGGAGCTCGTGGGACAGTCACCTCATGGAATTGGAGCTCGTGGAACAGTTACCTCTG
CCTCAGAAAACAAGGATGAATTAAGTTTTTTTTTAAAAAAGAAACATTTGGTAAGGGGAA
TTGAGGACACTGATATGGGTCTTGATAAATGGCTTCCTGGCAATAGTCAAATTGTGTGAA
AGGTACTTCAAATCCTTGAAGATTTACCACTTGTGTTTTGCAAGCCAGATTTTCCTGAAA
ACCCTTGCCATGTGCTAGTAATTGGAAAGGCAGCTCTAAATGTCAATCAGCCTAGTTGAT
CAGCTTATTGTCTAGTGAAACTCGTTAATTTGTAGTGTTGGAGAAGAACTGAAATCATAC
TTCTTAGGGTTATGATTAAGTAATGATAACTGGAAACTTCAGCGGTTTATATAAGCTTGT
ATTCCTTTTTCTCTCCTCTCCCCATGATGTTTAGAAACACAACTATATTGTTTGCTAAGC
ATTCCAACTATCTCATTTCCAAGCAAGTATTAGAATACCACAGGAACCACAAGACTGCAC
ATCAAAATATGCCCCATTCAACATCTAGTGAGCAGTCAGGAAAGAGAACTTCCAGATCCT
GGAAATCAGGGTTAGTATTGTCCAGGTCTACCAAAAATCTCAATATTTCAGATAATCACA
ATACATCCCTTACCTGGGAAAGGGCTGTTATAATCTTTCACAGGGGACAGGATGGTTCCC
TTGATGAAGAAGTTGATATGCCTTTTCCCAACTCCAGAAAGTGACAAGCTCACAGACCTT
TGAACTAGAGTTTAGCTGGAAAAGTATGTTAGTGCAAATTGTCACAGGACAGCCCTTCTT
TCCACAGAAGCTCCAGGTAGAGGGTGTGTAAGTAGATAGGCCATGGGCACTGTGGGTAGA
CACACATGAAGTCCAAGCATTTAGATGTATAGGTTGATGGTGGTATGTTTTCAGGCTAGA
TGTATGTACTTCATGCTGTCTACACTAAGAGAGAATGAGAGACACACTGAAGAAGCACCA
ATCATGAATTAGTTTTATATGCTTCTGTTTTATAATTTTGTGAAGCAAAATTTTTTCTCT
AGGAAATATTTATTTTAATAATGTTTCAAACATATATAACAATGCTGTATTTTAAAAGAA
TGATTATGAATTACATTTGTATAAAATAATTTTTATATTTGAAATATTGACTTTTTATGG
CACTAGTATTTCTATGAAATATTATGTTAAAACTGGGACAGGGGAGAACCTAGGGTGATA
TTAACCAGGGGCCATGAATCACCTTTTGGTCTGGAGGGAAGCCTTGGGGCTGATGCAGTT
GTTGCCCACAGCTGTATGATTCCCAGCCAGCACAGCCTCTTAGATGCAGTTCTGAAGAAG
ATGGTACCACCAGTCTGACTGTTTCCATCAAGGGTACACTGCCTTCTCAACTCCAAACTG
ACTCTTAAGAAGACTGCATTATATTTATTACTGTAAGAAAATATCACTTGTCAATAAAAT
CCATACATTTGTGT
gaaactttgttgttttcagatgcgttcacttgtcatgtttcatcagtctctcactccaat
ttctaagcttcatggaacatgaaacacgaatctgtcttttagatatagcctcttttgaga
attcacatgaattagaacacacatttttagttatctgtttaaactatggtaaaatataca