Gene CCL26 Variant 1
DNA : 2.73 KbNT_079595
mRNA : 534 bp NM_006072
CDS : 285 bp NP_006063
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  153 bp
gatccgcccacctcggtctcccagagtgctgtgatcacaggcatgagccaccacgcccag
tgccagattatctttcttcactgtctaatttcattcctatgagtattagtttacttttcc
tttgttgggtcaaaagtgctgcttctgttcccaaccacagaattctctggaattgttttc
AGGGCCGTCTCAGTCTCATAAAAGGGGATCAGGCAGGAGGAGTTTGGGAGAAACCTGAGA
AGGGCCTGATTTGCAGCATCATGATGGGCCTCTCCTTGGCCTCTGCTGTGCTCCTGGCCT
CCCTCCTGAGTCTCCACCTTGGAACTGCCACAC
gtacgtagctggcccattcccctcctggggttccttcccggaccgcctgggagtggatgg
aaatgagtatctccaaacccttcctctccctgatttttaggtgggagtgacatatccaag
acctgctgcttccaatacagccacaagccccttccctggacctgggtgcgaagctatgaa
EXON 2  115 bp
cagcatcatgatgggcctctccttggcctctgctgtgctcctggcctccctcctgagtct
ccaccttggaactgccacacgtacgtagctggcccattcccctcctggggttccttcccg
gaccgcctgggagtggatggaaatgagtatctccaaacccttcctctccctgatttttag
GTGGGAGTGACATATCCAAGACCTGCTGCTTCCAATACAGCCACAAGCCCCTTCCCTGGA
CCTGGGTGCGAAGCTATGAATTCACCAGTAACAGCTGCTCCCAGCGGGCTGTGAT
gtgagtatttctcggacgtactttctggggccccatcagtcatgcaacaggatgggtgct
gggcagacccccaggatgagccttgggatgggaacctggaaaccccacctctgcacacta
acaagtgtgactctgagcttcaggtagaacctgactttttttttctctttttgagacgga
EXON 3  266 bp
aaatcaagataggaaagaggagggagacaaggcccaggagaagaggggacagggacagag
agcaacaagtttgtggcaaggccagaagactagtgagagagctgcccctccttccctttc
tatcccaccccaggaggcaaagagtctcaatattgacttatccgtgtctctttttcacag
ATTCACTACCAAAAGAGGCAAGAAAGTCTGTACCCATCCAAGGAAAAAATGGGTGCAAAA
ATACATTTCTTTACTGAAAACTCCGAAACAATTGTGACTCAGCTGAATTTTCATCCGAGG
ACGCTTGGACCCCGCTCTTGGCTCTGCAGCCCTCTGGGGAGCCTGCGGAATCTTTTCTGA
AGGCTACATGGACCCGCTGGGGAGGAGAGGGTGTTTCCTCCCAGAGTTACTTTAATAAAG
GTTGTTCATAGAGTTGACTTGTTCAT
aacattttttgtccataaaacccgagttttctttaaggaaagaaaattgattcaatatgg
atggctggttgcctgggaggtccccaacccccgggcagaccccgatacggaattctgccg
tgggtttttgtttgtttgtgcaaaaaaaagcaagggtaattttaatacactttggtaaaa