Gene CALU Variant 1
DNA : 32.09 KbNT_079596
mRNA : 3317 bp NM_001219
CDS : 948 bp NP_001210
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  51 bp
gacgtggcgctttccagccaatcccggctatgcgattgttagaccaatggctactcgggg
acgctatgcgacagcggcgggtttgctgatgattggtcgggaggccgccggcgaggcgga
tgagggcggggtgcggacccgcttccggttgggcggtgcttgcgcgcgtgagctgagccg
GTGGGTGAGCGGCGGCCACGGCATCCTGTGCTGTGGGGGCTACGAGGAAAG
gtaagtacggtgatgcccagccccttcaccactgcctcatctttattcgctttctttctg
tccccggtcttgttcttggcgcggcaggggactgcctcactcggtgccgctgtctctgct
ggcgcccgggtcccaggcctgatgctgctggagatcccgggaccctctgtgtgcagcctg
EXON 2  232 bp
gaagagtctgatattccaccatacttattttatggatgaagtaatatttgggataatata
aaagacttgcatagatatgtatatcaaattaatagtttaactcggatgtgagcttttaat
ttcttatttagttattaagcatactgcctcctgaattaactgcttttcattttcttcaag
ATCTAATTATCATGGACCTGCGACAGTTTCTTATGTGCCTGTCCCTGTGCACAGCCTTTG
CCTTGAGCAAACCCACAGAAAAGAAGGACCGTGTACATCATGAGCCTCAGCTCAGTGACA
AGGTTCACAATGATGCTCAGAGTTTTGATTATGACCATGATGCCTTCTTGGGTGCTGAAG
AAGCAAAGACCTTTGATCAGCTGACACCAGAAGAGAGCAAGGAAAGGCTTGG
gtaaggtaccacctctcaggggtctagtgtgggtaatgacattctttataaaggctaatt
cttttcttttctggctcagttatgagtaaagttatattgaactattaatacatcttctga
aagctaaccatggaattactacctctaaaatttcattaaatgcctgatttcatacatttt
EXON 3  194 bp
ccttattcacgtggcttattacagaccagtaatggaccatttttttcagttgctggcctg
gcagttttgttttggagacaattttttatttctgtgcattagccctgggcacacacctgg
ctaagtccagagttctgtgtctttttaaccttttgctggatttctctgcattttctacag
AAAGATTGTAAGTAAAATAGATGGCGACAAGGACGGGTTTGTCACTGTGGATGAGCTCAA
AGACTGGATTAAATTTGCACAAAAGCGCTGGATTTACGAGGATGTAGAGCGACAGTGGAA
GGGGCATGACCTCAATGAGGACGGCCTCGTTTCCTGGGAGGAGTATAAAAATGCCACCTA
CGGCTACGTTTTAG
gtaggtccctactgtctgggggaaaaagccttgtggagctggcaccttgaaacgtaactg
ttttgtcttgtagaatgattgtagataaaatagacgcggataaagatgggtttgtgacgg
agggggagctgaaatcctggattaagcacgcccagaagaaatacatatatgacaatgttg
EXON 4  167 bp
tctgatgcctggagctgtagcccaaaactaaatgtctttgtactgctgcagttttacctg
tgtcatcaattatttcttccttgcatggttttatctttattggaaattgatttcccaccc
cacacattttcatgttttctgaaagtcttttaagatttgacctaaatttttgttttctag
ATGATCCAGATCCTGATGATGGATTTAACTATAAACAGATGATGGTTAGAGATGAGCGGA
GGTTTAAAATGGCAGACAAGGATGGAGACCTCATTGCCACCAAGGAGGAGTTCACAGCTT
TCCTGCACCCTGAGGAGTATGACTACATGAAAGATATAGTAGTACAG
gtgggtgagatgaaggattctgaacagggactcagtttctctttttgtggcttattctgt
ctttcccctttagccttatatagcatatcttatatatatatatgctatatagcatatcac
tgtatatgctatataagtattggccagattcagaatccaaggtctgtcactgtttttctg
EXON 5  61 bp
atttcttggctagaaatggttttaaccatacagacacacatgcatacatacatacataca
tacatacatgtacaagtgtgtttaatgaataataaatgtttacctaaactagatacttta
ctttcttctggcaaattcagagaccaacttaatagtctcttcttattctttcctgtttag
GAAACAATGGAAGATATAGATAAGAATGCTGATGGTTTCATTGATCTAGAAGAGTATATT
G
gtaagtctctgcttttagtgtttttcttagaaaagctgagaagctttgaaaggtgtattt
gctggctgggcacagtggctcatgcctgtaatcccaacactgggaggccgaggcgggcag
atcacctgaggtcaggagtccaagtccagcctggccaacatggggaaaccccgtctctac
EXON 6  200 bp
taagtgattaagcctcaggaaaataccttgctttctaaggtctgtctggcctaaaatacc
cttgtagctgctgttgggttccaaacaaatggatgaggaaaaagggttaggccagattag
catgaggcagttttggggaaaagacaaacccttcttttgtatgtatgtctgtgtacccag
GTGACATGTACAGCCATGATGGGAATACTGATGAGCCAGAATGGGTAAAGACAGAGCGAG
AGCAGTTTGTTGAGTTTCGGGATAAGAACCGTGATGGGAAGATGGACAAGGAAGAGACCA
AAGACTGGATCCTTCCCTCAGACTATGATCATGCAGAGGCAGAAGCCAGGCACCTGGTCT
ATGAATCAGACCAAAACAAG
gtaagtctggcgaggcccacacgctctatccttgattgaagtatgcttctaggggatcac
ctgaacagtttctgttaaggtgcatagagcatttaaggtcttaattagtctaagtcagcc
aagtatctgaatctggcgattaaaacctttcagggcagcactagctatctgatctcattt
EXON 7  2412 bp
ttgctgttttcttccctcttcgtatgtatgtagggggaatgagggctgagtagttcacac
ttaatttagtagaaatgagaatcttaacttctgattaaccccaattcttctataacagtg
tttctgaatttttaatgggaaatatgttcttcttcaattcattgctatctctactttcag
GATGGCAAGCTTACCAAGGAGGAGATCGTTGACAAGTATGACTTATTTGTTGGCAGCCAG
GCCACAGATTTTGGGGAGGCCTTAGTACGGCATGATGAGTTCTGAGCTACGGAGGAACCC
TCATTTCCTCAAAAGTAATTTATTTTTACAGCTTCTGGTTTCACATGAAATTGTTTGCGC
TACTGAGACTGTTACTACAAACTTTTTAAGACATGAAAAGGCGTAATGAAAACCATCCCG
TCCCCATTCCTCCTCCTCTCTGAGGGACTGGAGGGAAGCCGTGCTTCTGAGGAACAACTC
TAATTAGTACACTTGTGTTTGTAGATTTACACTTTGTATTATGTATTAACATGGCGTGTT
TATTTTTGTATTTTTCTCTGGTTGGGAGTATGATATGAAGGATCAAGATCCTCAACTCAC
ACATGTAGACAAACATTAGCTCTTTACTCTTTCTCAACCCCTTTTATGATTTTAATAATT
CTCACTTAACTAATTTTGTAAGCCTGAGATCAATAAGAAATGTTCAGGAGAGAGGAAAGA
AAAAAAATATATGCTCCACAATTTATATTTAGAGAGAGAACACTTAGTCTTGCCTGTCAA
AAAGTCCAACATTTCATAGGTAGTAGGGGCCACATATTACATTCAGTTGCTATAGGTCCA
GCAACTGAACCTGCCATTACCTGGGCAAGGAAAGATCCCTTTGCTCTAGGAAAGCTTGGC
CCAAATTGATTTTCTTCTTTTTCCCCCTGTAGGACTGACTGTTGGCTAATTTTGTCAAGC
ACAGCTGTGGTGGGAAGAGTTAGGGCCAGTGTCTTGAAAATCAATCAAGTAGTGAATGTG
ATCTCTTTGCAGAGCTATAGATAGAAACAGCTGGAAAACTAAAGGAAAAATACAAGTGTT
TTCGGGGCATACATTTTTTTTCTGGGTGTGCATCTGTTGAAATGCTCAAGACTTAATTAT
TTGCCTTTTGAAATCACTGTAAATGCCCCCATCCGGTTCCTCTTCTTCCCAGGTGTGCCA
AGGAATTAATCTTGGTTTCACTACAATTAAAATTCACTCCTTTCCAATCATGTCATTGAA
AGTGCCTTTAACGAAAGAAATGGTCACTGAATGGGAATTCTCTTAAGAAACCCTGAGATT
AAAAAAAGACTATTTGGATAACTTATAGGAAAGCCTAGAACCTCCCAGTAGAGTGGGGAT
TTTTTTCTTCTTCCCTTTCTCTTTTGGACAATAGTTAAATTAGCAGTATTAGTTATGAGT
TTGGTTGCAGTGTTCTTATCTTGTGGGCTGATTTCCAAAAACCACATGCTGCTGAATTTA
CCAGGGATCCTCATACCTCACAATGCAAACCACTTACTACCAGGCCTTTTTCTGTGTCCA
CTGGAGAGCTTGAGCTCACACTCAAAGATCAGAGGACCTACAGAGAGGGCTCTTTGGTTT
GAGGACCATGGCTTACCTTTCCTGCCTTTGACCCATCACACCCCATTTCCTCCTCTTTCC
CTCTCCCCGCTGCCAAAAAAAAAAAAAAAGGAAACGTTTATCATGAATCAACAGGGTTTC
AGTCCTTATCAAAGAGAGATGTGGAAAGAGCTAAAGAAACCACCCTTTGTTCCCAACTCC
ACTTTACCCATATTTTATGCAACACAAACACTGTCCTTTTGGGTCCCTTTCTTACAGATG
GACCTCTTGAGAAGAATTATCGTATTCCACGTTTTTAGCCCTCAGGTTACCAAGATAAAT
ATATGTATATATAACCTTTATTATTGCTATATCTTTGTGGATAATACATTCAGGTGGTGC
TGGGTGATTTATTATAATCTGAACCTAGGTATATCCTTTGGTCTTCCACAGTCATGTTGA
GGTGGGCTCCCTGGTATGGTAAAAAGCCAGGTATAATGTAACTTCACCCCAGCCTTTGTA
CTAAGCTCTTGATAGTGGATATACTCTTTTAAGTTTAGCCCCAATATAGGGTAATGGAAA
TTTCCTGCCCTCTGGGTTCCCCATTTTTACTATTAAGAAGACCAGTGATAATTTAATAAT
GCCACCAACTCTGGCTTAGTTAAGTGAGAGTGTGAACTGTGTGGCAAGAGAGCCTCACAC
CTCACTAGGTGCAGAGAGCCCAGGCCTTATGTTAAAATCATGCACTTGAAAAGCAAACCT
TAATCTGCAAAGACAGCAGCAAGCATTATACGGTCATCTTGAATGATCCCTTTGAAATTT
TTTTTTTGTTTGTTTGTTTAAATCAAGCCTGAGGCTGGTGAACAGTAGCTACACACCCAT
ATTGTGTGTTCTGTGAATGCTAGCTCTCTTGAATTTGGATATTGGTTATTTTTTATAGAG
TGTAAACCAAGTTTTATATTCTGCAATGCGAACAGGTACCTATCTGTTTCTAAATAAAAC
TGTTTACATTCA
ttatggggtatgtatgaccttcattttccaagaaatagaactctagcttagaattatgga
tgctctaaaatgtcagaatgggaactctcctcgaagttctcccaaactcagagacagcac
tgccttctcctaaatgattattcttttctccctgttttctggtattttctagcatccttc