Gene CALD1 Variant 5
DNA : 77.23 KbNT_079596
mRNA : 2124 bp NM_033140
CDS : 1599 bp NP_149131
NON CODANT MRNA CDS initiator and stop codon genomic and intronic adjacent sequences allelic variation
EXON 1  64 bp
gacaagcccagactttcgtcacagggacagaccaacgtgttaacacaaagggagaacacg
ggagcatcctgcaccgtgcatttcagccacagatcacatggcccctccgcgggcccagcc
cacgccctgaccgcccggcctggccaggtctccgtatctctctgccccgccgccccttcc
CAACTGCGGACATGCTGGGTGGATCCGGATCGCATGGAAGACGCAGCCTGGCCGCGCTCT
CCCA
gtgagtcctcatttcgcctctttggttttttcctttcttttttttttttataaaaaacaa
acgaattgttgtaaaaaaaaaaaaaaaaaaaaaaatgtgggagtgggaggggagaggagg
agacaccaggcaggaaaggaatgcagtgagtgtgtgagtttcagacctgtctgaaacttt
EXON 2  147 bp
aaaagtttgaaagctagctgactaggtcgctaaacttaaggaactgaaccatccttttag
acgtatgtggttcattaagcagtgaagttcagaaaagggctcagggctgttcctgccaag
aggttggtgaagacacgtggcaagtggcacgctcaagaggttgtctttgtaatgttgcag
AATCGCCTACCAGAGGAATGACGATGATGAAGAGGAGGCAGCCCGGGAACGGCGCCGCCG
AGCCCGACAGGAACGGCTGCGGCAGAAGCAGGAGGAAGAATCCTTGGGACAGGTGACCGA
CCAGGTGGAGGTGAATGCCCAGAACAG
gtactgtcctctttgggacggggagtttctaacttgcgtcttagcctgtccgttgaatgg
aatttgttgagcagagcattcctttctcagcccaactcaaccctttttcaatctaactgg
tttaattattttgcagtcattttaggcaactaatctgattagacaggcaatctgatttag
EXON 3  403 bp
cttgcaaatgctgtcagctgaaagccaggcaggcgtgtactaaaatggtaacgtactggg
gatatgggcaagcttggcactactggcatctgctgtagtcctgggtagcacaggctgtat
gaatgctgctgactgatgaatgagcaagctgtctttggtgttgttctttctgttgtacag
TGTGCCTGACGAGGAGGCCAAGACAACCACCACAAACACTCAAGTGGAAGGGGATGATGA
GGCCGCATTCCTGGAGCGCCTGGCTCGGCGTGAGGAAAGACGCCAAAAACGCCTTCAGGA
GGCTCTGGAGCGGCAGAAGGAGTTCGACCCAACAATAACAGATGCAAGTCTGTCGCTCCC
AAGCAGAAGAATGCAAAATGACACAGCAGAAAATGAAACTACCGAGAAGGAAGAAAAAAG
TGAAAGTCGCCAAGAAAGATACGAGATAGAGGAAACAGAAACAGTCACCAAGTCCTACCA
GAAGAATGATTGGAGGGATGCTGAAGAAAACAAGAAAGAAGACAAGGAAAAGGAGGAGGA
GGAAGAGGAGAAGCCAAAGCGAGGGAGCATTGGAGAAAATCAG
gtagaggtgatggtggaagagaaaacaactgaaagccaggaggaaacagtggtaatgtca
ttaaaaaatgggcagatcagttcagaagagcctaaacaagaggaggagagggaacaaggt
tcagatgagatttcccatcatgaaaagatggaagaggaagacaaggaaagagctgaggca
EXON 4  146 bp
gctaaaggaccatagctcattctctaagaatttcacctgattccaactctaccacatctg
agtggtttctttctgagttttctgccttcctaacaattttgggtcttacttgatgatacc
aaccaaaacctaataagatttttcttgttctgtttcttcctgatatgtactgttggttag
ATCAAAGATGAAAAGATTAAAAAGGACAAAGAACCCAAAGAAGAAGTTAAGAGCTTCATG
GATCGAAAGAAGGGATTTACAGAAGTTAAGTCGCAGAATGGAGAATTCATGACCCACAAA
CTTAAACATACTGAGAATACTTTCAG
gtaagaagtagcaactagttaatagaaactgtgttcacatgcaaagaaaaaaaaaaaaaa
gtcagtcttcccatcctgtgcttccagacagaaacgtgctaagcaggcagcatgcttttg
ttgtgaggtcattagccattgtcttagagatactcagtcagcaggtccagttcttatatc
EXON 5  262 bp
agcagaggctcctggactctgtgattccgggcagaccccttccccagcctaccccctggg
ctaatgagaggcagtgggtatttagtcggggatgcagaagccgcagaccgacctcccctt
cctccagggagactacaggcaaaagcatgtaaacccctttccattgccccccaaccacag
CCGCCCTGGAGGGAGGGCCAGCGTGGACACCAAGGAGGCTGAGGGCGCCCCCCAGGTGGA
AGCCGGCAAAAGGCTGGAGGAGCTTCGTCGTCGTCGCGGGGAGACCGAGAGCGAAGAGTT
CGAGAAGCTCAAACAGAAGCAGCAGGAGGCGGCTTTGGAGCTGGAGGAACTCAAGAAAAA
GAGGGAGGAGAGAAGGAAGGTCCTGGAGGAGGAAGAGCAGAGGAGGAAGCAGGAGGAAGC
CGATCGAAAACTCAGAGAGGAG
gtaaggcgggcgctagcccactgagaacgttgcccgggaaaattccctagtgccgtgcgg
ctgttcttttgagcatgggctctcaaaaatatttttttaagaataataaacttaccatgt
gctaggtactgttttataacttgtagatgtattaatttgtccactgcttctaagaactcg
EXON 6  141 bp
aaatgcaggcagctcgactccagctctcaggctaaacctctggtgaccacctagaagggg
agtgtccagcctgcggcctgagtctgctgcctctccaactgtgctctctctcctacagca
ctcttccctttggctgtgaagctggtactgatgcctcgttatttgttctttctctcttag
GAAGAGAAGAGGAGGCTAAAGGAAGAGATTGAAAGGCGAAGAGCAGAAGCTGCTGAGAAA
CGCCAGAAGATGCCAGAAGATGGCTTGTCAGATGACAAGAAACCATTCAAGTGTTTCACT
CCTAAAGGTTCATCTCTCAAG
gtatttttttccccagaaaacttctattagaatatgatagagactggattttagcccctt
gtttagttattgattatacagggcctttgttcatttatctttttgctatccttccaagtt
aatctgttcaggctgctataacaaaatactttagactggggccaggcacggtggctcatg
EXON 7  44 bp
cactatcaaataccttatatgtagttttgctttctagcagagctacgcacagtaactcaa
atacccttatatgctcttcggtgtgtttaacaggttcagggatgatattggcctgggctg
agaaacactgtttataagcttgaaatattaattgggtttattttcttttgtaattcctag
ATAGAAGAGCGAGCAGAATTTTTGAATAAGTCTGTGCAGAAAAG
gtaaatatgcttgatggttcaattgagctaatcagctagcatatgtatgagaagattctc
tctcatatttttatatgtatgtgtttacttttttagcagtggtgtcaaatcgacccatca
agcagcaatagtctccaagattgacagcagactggagcagtataccagtgcaattgaggt
EXON 8  82 bp
tgaaatattaattgggtttattttcttttgtaattcctagatagaagagcgagcagaatt
tttgaataagtctgtgcagaaaaggtaaatatgcttgatggttcaattgagctaatcagc
tagcatatgtatgagaagattctctctcatatttttatatgtatgtgtttacttttttag
CAGTGGTGTCAAATCGACCCATCAAGCAGCAATAGTCTCCAAGATTGACAGCAGACTGGA
GCAGTATACCAGTGCAATTGAG
gtgagaattgtcctcagcgttatggtcctgctgaacagaaatagattctgactacataga
agagcataaaaacacttaggacaataatcaagtccaatagccccaggagtgttagaattt
tttttttttttttttttgagacggagtctcactctgttgcccaggctggagtgcaatggc
EXON 9  138 bp
ttttgagggacatatgtcatcagcatacagttttacaacagaaattatcactctcatttt
tggtggaggtgtttacacaatgaatttttaagatgataatgttgaggaagacaaactcac
tataattttatgagaacaaacttcccagcaccaatcctaaaaataactcacaaatttcag
GGAACAAAAAGCGCAAAACCTACAAAGCCGGCAGCCTCGGATCTTCCTGTTCCTGCTGAA
GGTGTACGCAACATCAAGAGTATGTGGGAGAAAGGGAATGTGTTTTCATCCCCCACTGCA
GCAGGCACACCAAATAAG
gtgagcatctgatttttgtctcttaagtgtagaggggcatatttttttgcatgtcgattt
tgatttaggaatcacactagtaaataataaaagcagtgaagaaggtgcaatttgtacttt
gttttgcaatgaccacaaaagcaagctcagagagaatgtgtttgtgaggttgcatgaggt
EXON 10  96 bp
ttggagtggggtgagttaccagggaaagaaaaccagataacatattctgtaaatatcaag
tgttaaggtttatggttatgtgaaatcatacttaatgatattttgaatttgctttgaaaa
ttccttcccaggtaaagtttacttcattctttaatattttggatgattgcccctttgtag
GAAACTGCTGGCTTGAAGGTAGGGGTTTCTAGCCGCATCAATGAATGGCTAACTAAAACC
CCAGATGGAAACAAGTCACCTGCTCCCAAACCTTCT
gtaagtacctttaggtttttctgagtttctttgatctcccagcttctaccagcagaagaa
aacaagcagttggtctgtttacctaggaatggcagtgcccctgttctttgctttccctga
tgaatagcaaacaggaaagtgttcagatttacaacagttctaagaagctgcatctcagtt
EXON 11  81 bp
aaaaaataaaaaaatcaaacaacagctgatggtcctttcaattccatttcagatcactgg
ggtaaagtgtattaaacaacaaactgattcaaataaacaatagatgtggccatttattta
gagctggctagaaaatataaatggccacctatcgatgtttttctgcttcctttttatcag
GACTTGAGACCAGGAGACGTATCCAGCAAGCGGAACCTCTGGGAAAAGCAATCTGTGGAT
AAGGTCACTTCCCCCACTAAG
gtaatctattgggaagactagtatttcagaggtttgttttcctgatgtatggtgtagtat
aatgtcctggagtcagatgagaaatatcactgacctacagatctttgcctgcacacccat
cagtgtctaaaagaccagtacataacacagtgaaatgaaaagcgcattgcaagtttgtca
EXON 12  520 bp
gtaaaataaaagatcatatttgaatggaatgccgataataatcctccctttcataaatat
ttattcctgccatactattattcatttttcttctgactataaaaaccatctgcctgaaac
actgcaggctgtcagtttcacactacaggctgtcaatttcaagttctcttctcttggcag
GTTTGAGACAGTTCCAGAAAGAACCCAAGCTCAAGACGCAGGACGAGCTCAGTTGTAGAG
GGCTAATTCGCTCTGTTTTGTATTTATGTTGATTTACTAAATTGGGTTCATTATCTTTTA
TTTTTCAATATCCCAGTAAACCCATGTATATTATCACTATATTTAATAATCACAGTCTAG
AGATGTTCATGGTAAAAGTACTGCCTTTGCACAGGAGCCTGTTTCTAAAGAAACCCATGC
TGTGAAATAGAGACTTTTCTACTGATCATCATAACTCTGTATCTGAGCAGTGATACCAAC
CACATCTGAAGTCAACAGAAGATCCAAGTTTAAAATTGCCTGCGGAATGTGTGCAGTATC
TAGAAAAATGAACCGTAGTTTTTGTTTTTTTAAATACAGAAGTCATGTTGTTTCTGCACT
TTATAATAAAGCATGGAAGAAATTATCTTAGTAGGCAATTGTAACACTTTTTGAAAGTAA
CCCATTTCAGATTTGAAATACTGCAATAATGGTTGTCTTT
aaaaaaaaaaaagaaatgtactgttaaggtattactttttttcatgctgatgattcatat
ctaaattacattattatgttagctgacagtggtactgattttttaggttggttgttttgt
ggatttctttagtagtgatagtagcctgaaccacattttagataactcaattatgtatgt